Result : EXP00633

Protein Information

• Protein name: EXP00633
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 1007116
• Right: 1007196
• Strand: +
• Nucleotide Sequence: ATGATTATTATGTTTCCTGTGATTGCGATAAAGACAATGTCAGAAGTGGCCGATGGGCATTCGCCGCGGATTCACCGTTAG
• Sequence: MIIMFPVIAIKTMSEVADGHSPRIHR
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 26

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1131499	1131579	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	1002027	1002107	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	989095	989175	+	NC_004337.2	Shigella flexneri 2a str. 301
4	2750943	2751023	-	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_000913.3

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00419.22	1.0	3	1066.0	same-strand	Fimbrial protein
2	PF00345.22	0.67	2	1862	same-strand	Pili and flagellar-assembly chaperone, PapD N-terminal domain
3	PF02753.19	0.67	2	2348.0	same-strand	Pili assembly chaperone PapD, C-terminal domain
4	PF13954.8	0.67	2	211	same-strand	PapC N-terminal domain
5	PF00577.22	0.67	2	211	same-strand	Outer membrane usher protein
6	PF13953.8	1.0	3	211.0	same-strand	PapC C-terminal domain
7	PF01180.23	0.67	2	2661	same-strand	Dihydroorotate dehydrogenase
8	PF07126.14	0.67	2	3845	same-strand	Cell-division protein ZapC
9	PF03358.17	0.67	2	4686.0	opposite-strand	NADPH-dependent FMN reductase