Result : EXP00626
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00626 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1182699 |
| Right | 1182791 |
| Strand | + |
| Nucleotide Sequence | CTGACCTGGTCGTCATTGGTGGTGGCTTATCGAATTTCCCGGCAATCACAACGCAACTGGCGGACAGGCTGCCTCGTCATCTCTTACCTGTAG |
| Sequence | LTWSSLVVAYRISRQSQRNWRTGCLVISYL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1538613 | 1538687 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1179347 | 1179421 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1167088 | 1167162 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 1760386 | 1760460 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1184128 | 1184205 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01757.24 | 0.75 | 3 | 4182.0 | opposite-strand | Acyltransferase family |
| 2 | PF12704.9 | 1.0 | 4 | 1750.0 | same-strand | MacB-like periplasmic core domain |
| 3 | PF02687.23 | 1.0 | 4 | 1750.0 | same-strand | FtsX-like permease family |
| 4 | PF00005.29 | 1.0 | 4 | 2027 | same-strand | ABC transporter |
| 5 | PF02463.21 | 1.0 | 4 | 2027 | same-strand | RecF/RecN/SMC N terminal domain |
| 6 | PF00480.22 | 1.0 | 4 | -74 | same-strand | ROK family |
| 7 | PF02685.18 | 1.0 | 4 | -74 | same-strand | Glucokinase |
| 8 | PF02146.19 | 1.0 | 4 | 99 | same-strand | Sir2 family |
| 9 | PF13416.8 | 1.0 | 4 | 1076 | opposite-strand | Bacterial extracellular solute-binding protein |
| 10 | PF13343.8 | 1.0 | 4 | 1076 | opposite-strand | Bacterial extracellular solute-binding protein |
| 11 | PF13531.8 | 1.0 | 4 | 1076 | opposite-strand | Bacterial extracellular solute-binding protein |
| 12 | PF01547.27 | 1.0 | 4 | 1076 | opposite-strand | Bacterial extracellular solute-binding protein |
| 13 | PF00528.24 | 1.0 | 4 | 2910 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
++ More..