Result : EXP00619
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00619 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 2164734 |
| Right | 2164787 |
| Strand | + |
| Nucleotide Sequence | TTGTTTCAACATGCCCAGGTAATTAGTCTCGTGTCGCTTGGCATTTTTTTATAA |
| Sequence | LFQHAQVISLVSLGIFL |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 17 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2269885 | 2269938 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 2293087 | 2293140 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 2816546 | 2816599 | + | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 2759966 | 2760019 | + | NZ_CP061527.1 | Shigella dysenteriae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03692.17 | 1.0 | 4 | 4590.0 | opposite-strand | Putative zinc- or iron-chelating domain |
| 2 | PF09285.13 | 1.0 | 4 | 3863.0 | same-strand | Elongation factor P, C-terminal |
| 3 | PF08207.14 | 1.0 | 4 | 3863.0 | same-strand | Elongation factor P (EF-P) KOW-like domain |
| 4 | PF01132.22 | 1.0 | 4 | 3863.0 | same-strand | Elongation factor P (EF-P) OB domain |
| 5 | PF08125.15 | 1.0 | 4 | 2175.0 | same-strand | Mannitol dehydrogenase C-terminal domain |
| 6 | PF01232.25 | 1.0 | 4 | 2175.0 | same-strand | Mannitol dehydrogenase Rossmann domain |
| 7 | PF02492.21 | 1.0 | 4 | 1070.0 | same-strand | CobW/HypB/UreG, nucleotide-binding domain |
| 8 | PF07683.16 | 1.0 | 4 | 1070.0 | same-strand | Cobalamin synthesis protein cobW C-terminal domain |
| 9 | PF00877.21 | 1.0 | 4 | 41.0 | same-strand | NlpC/P60 family |
| 10 | PF00563.22 | 1.0 | 4 | 789.0 | same-strand | EAL domain |
| 11 | PF12792.9 | 1.0 | 4 | 789.0 | same-strand | CSS motif domain associated with EAL |
| 12 | PF00496.24 | 1.0 | 4 | 2426.0 | same-strand | Bacterial extracellular solute-binding proteins, family 5 Middle |
| 13 | PF00528.24 | 1.0 | 4 | 4789.0 | same-strand | Binding-protein-dependent transport system inner membrane component |
++ More..