Result : EXP00617
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00617 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 1393157 |
| Right | 1393204 |
| Strand | + |
| Nucleotide Sequence | ATGTTGCGTAACAGGGCCAGAAGGCTAGACTACAAAATAATGCGTTGA |
| Sequence | MLRNRARRLDYKIMR |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed in both exponential and stationary phase in rich medium; expression is slightly higher in stationary phase (at protein level) Pubmed:30837344 |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSF1 |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1917598 | 1917645 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 2 | 1407989 | 1408036 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 3 | 1867088 | 1867135 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 4 | 2293182 | 2293229 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 1448590 | 1448637 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_002695.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01713.23 | 1.0 | 4 | 1447 | same-strand | Smr domain |
| 2 | PF00990.23 | 0.75 | 3 | 194.5 | opposite-strand | Diguanylate cyclase, GGDEF domain |
| 3 | PF08448.12 | 0.75 | 3 | 194.0 | opposite-strand | PAS fold |
| 4 | PF13426.9 | 0.75 | 3 | 194.0 | opposite-strand | PAS domain |
| 5 | PF01544.20 | 1.0 | 4 | 14 | same-strand | CorA-like Mg2+ transporter protein |
| 6 | PF00270.31 | 0.75 | 3 | 1475.0 | same-strand | DEAD/DEAH box helicase |
| 7 | PF00271.33 | 1.0 | 4 | 1475 | same-strand | Helicase conserved C-terminal domain |
| 8 | PF03880.17 | 1.0 | 4 | 1475 | same-strand | DbpA RNA binding domain |
| 9 | PF04851.17 | 0.75 | 3 | 1475.0 | same-strand | Type III restriction enzyme, res subunit |
| 10 | PF01171.22 | 1.0 | 4 | 2971 | opposite-strand | PP-loop family |
++ More..