ProsmORF-pred
Result : EXP00614
Protein Information
Information Type Description
Protein name EXP00614
NCBI Accession ID CP001509.3
Organism Escherichia coli BL21(DE3)
Left 373725
Right 373808
Strand +
Nucleotide Sequence ATCGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGTCATGCAGCTCCACCGATTTTGA
Sequence IGNDSNLLIVFYVQIMPDDFVMQLHRF
Source of smORF Ribo-seq
Function
Pubmed ID 30904393
Domain
Functional Category Function not yet assigned
Uniprot ID
ORF Length (Amino Acid) 27
++ More..
Conservation Analysis
Conservation Analysis
No. of Species: 10
Sr.No. Left Position Right Position Strand NCBI Accession id Species Name
1 2031008 2031091 + NZ_CP061527.1 Shigella dysenteriae
2 2528099 2528182 + NZ_CP061527.1 Shigella dysenteriae
3 3528886 3528969 + NZ_CP061527.1 Shigella dysenteriae
4 1399667 1399759 + NZ_CP061527.1 Shigella dysenteriae
5 1243476 1243562 - NZ_CP061527.1 Shigella dysenteriae
6 1993165 1993248 + NZ_CP061527.1 Shigella dysenteriae
7 3234959 3235045 + NZ_CP061527.1 Shigella dysenteriae
8 1946723 1946812 - NZ_CP061527.1 Shigella dysenteriae
9 2667376 2667471 + NZ_CP061527.1 Shigella dysenteriae
10 3888837 3888923 + NZ_CP061527.1 Shigella dysenteriae
11 3584145 3584240 + NZ_CP061527.1 Shigella dysenteriae
12 3760673 3760771 - NZ_CP061527.1 Shigella dysenteriae
13 286963 287052 + NZ_CP061527.1 Shigella dysenteriae
14 560756 560839 - NZ_CP061527.1 Shigella dysenteriae
15 223105 223191 + NZ_CP061527.1 Shigella dysenteriae
16 846589 846672 - NZ_CP061527.1 Shigella dysenteriae
17 3375845 3375928 - NZ_CP061527.1 Shigella dysenteriae
18 3463205 3463297 - NZ_CP061527.1 Shigella dysenteriae
19 3111608 3111703 - NZ_CP061527.1 Shigella dysenteriae
20 4010278 4010370 + NZ_CP061527.1 Shigella dysenteriae
21 4038090 4038179 + NZ_CP061527.1 Shigella dysenteriae
22 4118277 4118363 + NZ_CP061527.1 Shigella dysenteriae
23 265639 265728 - NZ_CP061527.1 Shigella dysenteriae
24 550691 550786 + NZ_CP061527.1 Shigella dysenteriae
25 3063598 3063681 - NZ_CP061527.1 Shigella dysenteriae
26 2077242 2077325 + NZ_CP061527.1 Shigella dysenteriae
27 1693680 1693763 - NZ_CP061527.1 Shigella dysenteriae
28 3954532 3954627 + NZ_CP061527.1 Shigella dysenteriae
29 3794312 3794407 - NZ_CP061527.1 Shigella dysenteriae
30 2942132 2942221 - NZ_CP061527.1 Shigella dysenteriae
31 4065104 4065181 + NZ_CP061527.1 Shigella dysenteriae
32 2287443 2287526 + NC_004337.2 Shigella flexneri 2a str. 301
33 3693795 3693890 - NC_004337.2 Shigella flexneri 2a str. 301
34 3182268 3182354 - NC_004337.2 Shigella flexneri 2a str. 301
35 1766523 1766609 + NC_004337.2 Shigella flexneri 2a str. 301
36 1736661 1736753 - NC_004337.2 Shigella flexneri 2a str. 301
37 1410568 1410651 - NC_004337.2 Shigella flexneri 2a str. 301
38 2756772 2756855 - NC_004337.2 Shigella flexneri 2a str. 301
39 1856674 1856763 - NC_004337.2 Shigella flexneri 2a str. 301
40 4478671 4478754 - NC_004337.2 Shigella flexneri 2a str. 301
41 3362655 3362738 - NC_004337.2 Shigella flexneri 2a str. 301
42 379326 379409 - NC_004337.2 Shigella flexneri 2a str. 301
43 1769719 1769802 - NC_004337.2 Shigella flexneri 2a str. 301
44 3728508 3728591 - NC_004337.2 Shigella flexneri 2a str. 301
45 1533614 1533697 + NC_004337.2 Shigella flexneri 2a str. 301
46 1366141 1366224 - NC_004337.2 Shigella flexneri 2a str. 301
47 521442 521525 - NC_004337.2 Shigella flexneri 2a str. 301
48 4570410 4570502 - NC_004337.2 Shigella flexneri 2a str. 301
49 1295068 1295154 + NC_004337.2 Shigella flexneri 2a str. 301
50 87628 87714 - NC_004337.2 Shigella flexneri 2a str. 301
51 83951 84037 + NZ_CP061511.1 Mixta calida
52 551013 551105 - NZ_CP061511.1 Mixta calida
53 2809613 2809705 + NZ_CP061511.1 Mixta calida
54 2917745 2917828 - NZ_CP061511.1 Mixta calida
55 3095214 3095303 + NZ_CP061511.1 Mixta calida
56 2100051 2100134 + NZ_CP045205.1 Citrobacter telavivensis
57 2827529 2827612 + NZ_CP045205.1 Citrobacter telavivensis
58 2407119 2407214 - NZ_CP045205.1 Citrobacter telavivensis
59 149844 149930 + NZ_CP011600.1 Phytobacter ursingii
60 257899 257988 + NC_000913.3 Escherichia coli str. K-12 substr. MG1655
61 1978500 1978583 + NC_000913.3 Escherichia coli str. K-12 substr. MG1655
62 4519159 4519245 - NC_000913.3 Escherichia coli str. K-12 substr. MG1655
63 2711214 2711306 - NZ_CP011602.1 Phytobacter ursingii
64 3156911 3157006 + NZ_CP043318.1 Enterobacter chengduensis
65 161816 161902 - NZ_CP061512.1 Mixta calida
66 50511 50597 - NZ_CP036176.1 Klebsiella huaxiensis
67 178268 178363 + NC_004851.1 Shigella flexneri 2a str. 301
68 832889 832972 + NZ_CP016176.1 Xenorhabdus hominickii
69 2771859 2771951 - NZ_CP016176.1 Xenorhabdus hominickii
70 1743468 1743551 + NC_013892.1 Xenorhabdus bovienii SS-2004
++ More..
Neighborhood Conservation Analysis
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Conservation Analysis
Neighborhood Representative Chosen(Species): NZ_CP061527.1
Sr.No. Domain Co-occurrence Frequency No. of species in which domain occurs with smORF Median distance b/w smORF and domain bearing ORFs Orientation relative to smORF PFAM Information
1 PF03811.15 0.6 6 1237.0 opposite-strand InsA N-terminal domain
2 PF03400.15 0.8 8 -65.0 opposite-strand IS1 transposase
++ More..