Result : EXP00608

Protein Information

• Protein name: EXP00608
• NCBI Accession ID: CP001509.3
• Organism: Escherichia coli BL21(DE3)
• Left: 1393149
• Right: 1393184
• Strand: +
• Nucleotide Sequence: GTGATGAGATGTTGCGTAACAGGGCCAGAAGGCTAG
• Sequence: VMRCCVTGPEG
• Source of smORF: Ribo-seq
• Pubmed ID: 30904393
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 11

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1917590	1917625	+	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	1407981	1408016	+	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	1867108	1867143	-	NC_004337.2	Shigella flexneri 2a str. 301
4	2293202	2293237	-	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF01713.23	1.0	3	1439.0	same-strand	Smr domain
2	PF00990.23	0.67	2	186	opposite-strand	Diguanylate cyclase, GGDEF domain
3	PF08448.12	0.67	2	186	opposite-strand	PAS fold
4	PF13426.9	0.67	2	186	opposite-strand	PAS domain
5	PF01544.20	1.0	3	34.0	same-strand	CorA-like Mg2+ transporter protein
6	PF00270.31	0.67	2	1495	same-strand	DEAD/DEAH box helicase
7	PF00271.33	1.0	3	1495.0	same-strand	Helicase conserved C-terminal domain
8	PF03880.17	1.0	3	1495.0	same-strand	DbpA RNA binding domain
9	PF04851.17	0.67	2	1495	same-strand	Type III restriction enzyme, res subunit
10	PF01171.22	1.0	3	2994.0	opposite-strand	PP-loop family