Result : EXP00606
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00606 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4456929 |
| Right | 4456985 |
| Strand | + |
| Nucleotide Sequence | ATGCTCACTGTGTCGCCAATTATCAACTGCCACCAGAGAGTCAGCAGCAGTTATTAA |
| Sequence | MLTVSPIINCHQRVSSSY |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4547650 | 4547706 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4376736 | 4376792 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 5402668 | 5402724 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 543927 | 543983 | + | NZ_LR134340.1 | Escherichia marmotae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00419.22 | 1.0 | 3 | 2242.5 | same-strand | Fimbrial protein |
| 2 | PF00345.22 | 1.0 | 3 | 2621.0 | same-strand | Pili and flagellar-assembly chaperone, PapD N-terminal domain |
| 3 | PF02753.19 | 1.0 | 3 | 2621.0 | same-strand | Pili assembly chaperone PapD, C-terminal domain |
| 4 | PF00577.22 | 1.0 | 3 | -56.0 | same-strand | Outer membrane usher protein |
| 5 | PF13954.8 | 1.0 | 3 | -56.0 | same-strand | PapC N-terminal domain |
| 6 | PF13953.8 | 1.0 | 3 | -56.0 | same-strand | PapC C-terminal domain |
| 7 | PF09160.12 | 1.0 | 3 | 1102.0 | same-strand | FimH, mannose binding |
| 8 | PF02447.18 | 1.0 | 3 | 2217.5 | opposite-strand | GntP family permease |
| 9 | PF03786.15 | 0.67 | 2 | 3871 | same-strand | D-mannonate dehydratase (UxuA) |
++ More..