Result : EXP00598
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00598 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 4408268 |
| Right | 4408324 |
| Strand | + |
| Nucleotide Sequence | ATGGCATTAACAGATATCAAAGTCAGAGCAGCCAAGCCAACGGATAAGCAATATTAG |
| Sequence | MALTDIKVRAAKPTDKQY |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4496675 | 4496731 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 3978318 | 3978374 | - | NZ_CP011602.1 | Phytobacter ursingii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00107.28 | 1.0 | 2 | 2165 | opposite-strand | Zinc-binding dehydrogenase |
| 2 | PF08240.14 | 1.0 | 2 | 2165 | opposite-strand | Alcohol dehydrogenase GroES-like domain |
| 3 | PF13602.8 | 1.0 | 2 | 2165 | opposite-strand | Zinc-binding dehydrogenase |
| 4 | PF01527.22 | 1.0 | 2 | 828.5 | same-strand | Transposase |
| 5 | PF00665.28 | 1.0 | 2 | 1157.5 | same-strand | Integrase core domain |
| 6 | PF13683.8 | 1.0 | 2 | 1157.5 | same-strand | Integrase core domain |
++ More..