Result : EXP00596
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00596 |
| NCBI Accession ID | CP001509.3 |
| Organism | Escherichia coli BL21(DE3) |
| Left | 88526 |
| Right | 88576 |
| Strand | + |
| Nucleotide Sequence | TTGATATTTATGATGCATTGCATACCGTGGGTGGTATTGATCATGTATTAG |
| Sequence | LIFMMHCIPWVVLIMY |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 30904393 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 85721 | 85771 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 83562 | 83612 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 3 | 708017 | 708067 | + | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 3508250 | 3508300 | - | NZ_CP061527.1 | Shigella dysenteriae |
| 5 | 90327 | 90377 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 6 | 87043 | 87093 | + | NZ_AP014857.1 | Escherichia albertii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00330.22 | 0.8 | 4 | 4856 | opposite-strand | Aconitase family (aconitate hydratase) |
| 2 | PF00180.22 | 0.8 | 4 | 3762 | opposite-strand | Isocitrate/isopropylmalate dehydrogenase |
| 3 | PF00682.21 | 1.0 | 5 | 2191.5 | opposite-strand | HMGL-like |
| 4 | PF08502.12 | 1.0 | 5 | 2191.5 | opposite-strand | LeuA allosteric (dimerisation) domain |
| 5 | PF00126.29 | 0.8 | 4 | 409 | same-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 6 | PF03466.22 | 0.8 | 4 | 409 | same-strand | LysR substrate binding domain |
| 7 | PF02776.20 | 1.0 | 5 | -50.0 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 8 | PF02775.23 | 1.0 | 5 | -50.0 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 9 | PF00205.24 | 1.0 | 5 | -50.0 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 10 | PF10369.11 | 1.0 | 5 | 1586.0 | same-strand | Small subunit of acetolactate synthase |
| 11 | PF13710.8 | 1.0 | 5 | 1586.0 | same-strand | ACT domain |
| 12 | PF01842.27 | 1.0 | 5 | 1586.0 | same-strand | ACT domain |
| 13 | PF13291.8 | 1.0 | 5 | 1586.0 | same-strand | ACT domain |
| 14 | PF00356.23 | 1.0 | 5 | 2257.0 | same-strand | Bacterial regulatory proteins, lacI family |
| 15 | PF00532.23 | 1.0 | 5 | 2257.0 | same-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 16 | PF13377.8 | 1.0 | 5 | 2257.0 | same-strand | Periplasmic binding protein-like domain |
| 17 | PF13407.8 | 1.0 | 5 | 2257.0 | same-strand | Periplasmic binding protein domain |
| 18 | PF02381.20 | 1.0 | 5 | 3863.5 | same-strand | MraZ protein, putative antitoxin-like |
| 19 | PF01795.21 | 1.0 | 5 | 4323.5 | same-strand | MraW methylase family |
| 20 | PF04999.15 | 0.6 | 3 | 5261.0 | same-strand | Cell division protein FtsL |
++ More..