Result : EXP00586
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00586 |
| NCBI Accession ID | CP008957.1 |
| Organism | Escherichia coli O157:H7 str. EDL933 |
| Left | 4812147 |
| Right | 4812380 |
| Strand | + |
| Nucleotide Sequence | ATGAGGGTGAGCCATAATGAAGTGGCGTCCTTTCGTCAAAAGTTCTGCGTAAATTGCGAGTATAGACGTTTCTTGCTGGTGGCTAAAATAGTCTCAAAGGGAGGGTATTTTTCTTTGAGCCAGGTTAATGTGGCCGCATTTAGGAGTACGATTTTGCCGTTAATCGTGCATACTGTGCGCTTTTTTGTGGGCCAAGGGACTAAGCACACATTTCATATTTCAACGAAAGACTAG |
| Sequence | MRVSHNEVASFRQKFCVNCEYRRFLLVAKIVSKGGYFSLSQVNVAAFRSTILPLIVHTVRFFVGQGTKHTFHISTKD |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 26911138 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 77 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3931079 | 3931312 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 2 | 4724648 | 4724881 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 3 | 4411798 | 4412031 | - | NZ_LR134340.1 | Escherichia marmotae |
| 4 | 3897966 | 3898199 | + | NZ_AP014857.1 | Escherichia albertii |
| 5 | 1179651 | 1179857 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_000913.3
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00258.27 | 1.0 | 4 | 4624 | opposite-strand | Flavodoxin |
| 2 | PF01037.23 | 1.0 | 4 | 4076 | opposite-strand | Lrp/AsnC ligand binding domain |
| 3 | PF13412.8 | 1.0 | 4 | 4076 | opposite-strand | Winged helix-turn-helix DNA-binding |
| 4 | PF13404.8 | 1.0 | 4 | 4076 | opposite-strand | AsnC-type helix-turn-helix domain |
| 5 | PF03590.17 | 1.0 | 4 | 2932 | same-strand | Aspartate-ammonia ligase |
| 6 | PF13519.8 | 1.0 | 4 | 1476 | opposite-strand | von Willebrand factor type A domain |
| 7 | PF20030.1 | 1.0 | 4 | -14 | opposite-strand | MoxR domain in the MoxR-vWA-beta-propeller ternary systems |
| 8 | PF07728.16 | 1.0 | 4 | -14 | opposite-strand | AAA domain (dynein-related subfamily) |
| 9 | PF12592.10 | 1.0 | 4 | -14 | opposite-strand | Protein of unknown function (DUF3763) |
| 10 | PF17868.3 | 1.0 | 4 | -14 | opposite-strand | AAA lid domain |
| 11 | PF07726.13 | 0.75 | 3 | -14.0 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 12 | PF02705.18 | 1.0 | 4 | 4 | same-strand | K+ potassium transporter |
| 13 | PF05025.15 | 1.0 | 4 | 2040 | same-strand | RbsD / FucU transport protein family |
| 14 | PF00005.29 | 1.0 | 4 | 2467 | same-strand | ABC transporter |
| 15 | PF02653.18 | 1.0 | 4 | 3977 | same-strand | Branched-chain amino acid transport system / permease component |
| 16 | PF13407.8 | 1.0 | 4 | 4967 | same-strand | Periplasmic binding protein domain |
| 17 | PF00532.23 | 1.0 | 4 | 4967 | same-strand | Periplasmic binding proteins and sugar binding domain of LacI family |
| 18 | PF13377.8 | 1.0 | 4 | 4967 | same-strand | Periplasmic binding protein-like domain |
++ More..