Result : B1LV85
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Coenzyme PQQ synthesis protein A (Pyrroloquinoline quinone biosynthesis protein A) |
| NCBI Accession ID | CP001001.1 |
| Organism | Methylobacterium radiotolerans (strain ATCC 27329 / DSM 1819 / JCM 2831 / NBRC 15690 / NCIMB 10815 / 0-1) |
| Left | 556294 |
| Right | 556383 |
| Strand | - |
| Nucleotide Sequence | ATGAAGTGGGCTGCCCCGATCGTGTCCGAGATCTGCGTCGGCATGGAAGTGACGAGCTACGAGTCGGCCGAGATCGACACCTTCAACTGA |
| Sequence | MKWAAPIVSEICVGMEVTSYESAEIDTFN |
| Source of smORF | Swiss-Prot |
| Function | Required for coenzyme pyrroloquinoline quinone (PQQ) biosynthesis. PQQ is probably formed by cross-linking a specific glutamate to a specific tyrosine residue and excising these residues from the peptide. {ECO:0000255|HAMAP-Rule:MF_00656}. |
| Pubmed ID | |
| Domain | CDD:391614 |
| Functional Category | Others |
| Uniprot ID | B1LV85 |
| ORF Length (Amino Acid) | 29 |
++ More..
| Conservation Analysis |
No. of Species: 23
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 675448 | 675537 | - | NZ_CP003811.1 | Methylobacterium oryzae CBMB20 |
| 2 | 6027457 | 6027546 | - | NZ_CP003811.1 | Methylobacterium oryzae CBMB20 |
| 3 | 6027287 | 6027376 | - | NZ_CP003811.1 | Methylobacterium oryzae CBMB20 |
| 4 | 29602 | 29691 | - | NZ_CP015367.1 | Methylobacterium phyllosphaerae |
| 5 | 5070898 | 5070987 | - | NZ_CP015367.1 | Methylobacterium phyllosphaerae |
| 6 | 5070728 | 5070817 | - | NZ_CP015367.1 | Methylobacterium phyllosphaerae |
| 7 | 556294 | 556383 | - | NC_010505.1 | Methylobacterium radiotolerans JCM 2831 |
| 8 | 5765421 | 5765510 | - | NC_010505.1 | Methylobacterium radiotolerans JCM 2831 |
| 9 | 5765253 | 5765342 | - | NC_010505.1 | Methylobacterium radiotolerans JCM 2831 |
| 10 | 1878392 | 1878481 | - | NZ_CP039546.1 | Methylorubrum populi |
| 11 | 4636219 | 4636308 | + | NZ_CP039546.1 | Methylorubrum populi |
| 12 | 4636381 | 4636470 | + | NZ_CP039546.1 | Methylorubrum populi |
| 13 | 166587 | 166676 | - | NZ_CP039546.1 | Methylorubrum populi |
| 14 | 3441708 | 3441797 | - | NZ_CP043538.1 | Methylobacterium mesophilicum SR1.6/6 |
| 15 | 2738677 | 2738766 | + | NZ_CP043538.1 | Methylobacterium mesophilicum SR1.6/6 |
| 16 | 2738505 | 2738594 | + | NZ_CP043538.1 | Methylobacterium mesophilicum SR1.6/6 |
| 17 | 4488535 | 4488624 | - | NZ_CP029550.1 | Methylobacterium durans |
| 18 | 1389520 | 1389609 | + | NZ_CP029550.1 | Methylobacterium durans |
| 19 | 1389834 | 1389923 | + | NZ_CP029550.1 | Methylobacterium durans |
| 20 | 1389675 | 1389764 | + | NZ_CP029550.1 | Methylobacterium durans |
| 21 | 1150573 | 1150662 | + | NZ_CP029550.1 | Methylobacterium durans |
| 22 | 6096038 | 6096127 | - | NC_011894.1 | Methylobacterium nodulans ORS 2060 |
| 23 | 6096206 | 6096295 | - | NC_011894.1 | Methylobacterium nodulans ORS 2060 |
| 24 | 3847588 | 3847677 | + | NZ_CP029553.1 | Methylobacterium terrae |
| 25 | 3847804 | 3847893 | + | NZ_CP029553.1 | Methylobacterium terrae |
| 26 | 1870996 | 1871073 | + | NZ_CP025086.1 | Methylovirgula ligni |
| 27 | 2115293 | 2115370 | - | NZ_CP025086.1 | Methylovirgula ligni |
| 28 | 4209632 | 4209709 | + | NZ_CP046052.1 | Methylocystis heyeri |
| 29 | 2200471 | 2200548 | - | NZ_CP046052.1 | Methylocystis heyeri |
| 30 | 1231994 | 1232071 | + | NC_011666.1 | Methylocella silvestris BL2 |
| 31 | 3922165 | 3922242 | + | NZ_CP044331.1 | Methylocystis parvus |
| 32 | 1056966 | 1057043 | + | NZ_CP019948.1 | Methylocystis bryophila |
| 33 | 2935307 | 2935384 | + | NZ_CP019948.1 | Methylocystis bryophila |
| 34 | 3779137 | 3779214 | - | NC_010581.1 | Beijerinckia indica subsp. indica ATCC 9039 |
| 35 | 2127643 | 2127720 | + | NZ_CP023559.1 | Salinicola tamaricis |
| 36 | 1084880 | 1084957 | + | NZ_CP043420.1 | Kushneria phosphatilytica |
| 37 | 4266479 | 4266556 | + | NZ_CP030265.1 | Skermanella pratensis |
| 38 | 3782757 | 3782834 | + | NZ_CP048630.1 | Ancylobacter pratisalsi |
| 39 | 2160432 | 2160521 | - | NC_014313.1 | Hyphomicrobium denitrificans ATCC 51888 |
| 40 | 1537937 | 1538026 | - | NC_014313.1 | Hyphomicrobium denitrificans ATCC 51888 |
| 41 | 1510210 | 1510299 | + | NC_014313.1 | Hyphomicrobium denitrificans ATCC 51888 |
| 42 | 2390747 | 2390836 | - | NC_014313.1 | Hyphomicrobium denitrificans ATCC 51888 |
| 43 | 23746 | 23823 | + | NC_022997.1 | Hyphomicrobium nitrativorans NL23 |
| 44 | 1066966 | 1067043 | - | NC_022997.1 | Hyphomicrobium nitrativorans NL23 |
| 45 | 1030504 | 1030593 | + | NC_022997.1 | Hyphomicrobium nitrativorans NL23 |
| 46 | 23064 | 23153 | + | NC_022997.1 | Hyphomicrobium nitrativorans NL23 |
| 47 | 2736300 | 2736389 | + | NC_022997.1 | Hyphomicrobium nitrativorans NL23 |
| 48 | 2782315 | 2782392 | - | NC_022997.1 | Hyphomicrobium nitrativorans NL23 |
| 49 | 3257817 | 3257909 | + | NZ_CP038439.1 | Paracoccus liaowanqingii |
| 50 | 86086 | 86175 | + | NZ_AP014648.1 | Methyloceanibacter caenitepidi |
| 51 | 85505 | 85594 | + | NZ_AP014648.1 | Methyloceanibacter caenitepidi |
| 52 | 85806 | 85895 | + | NZ_AP014648.1 | Methyloceanibacter caenitepidi |
| 53 | 728162 | 728242 | + | NZ_CP030126.1 | Indioceanicola profundi |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP003811.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF04055.23 | 0.83 | 19 | 2191 | same-strand | Radical SAM superfamily |
| 2 | PF13186.8 | 0.83 | 19 | 2193 | same-strand | Iron-sulfur cluster-binding domain |
| 3 | PF03070.18 | 0.83 | 19 | 1072 | same-strand | TENA/THI-4/PQQC family |
| 4 | PF05402.14 | 0.83 | 19 | 1701 | same-strand | Coenzyme PQQ synthesis protein D (PqqD) |
| 5 | PF12706.9 | 0.83 | 19 | 46 | same-strand | Beta-lactamase superfamily domain |
| 6 | PF00072.26 | 0.61 | 14 | 408 | same-strand | Response regulator receiver domain |
++ More..