Result : EXP00525

Protein Information

• Protein name: EXP00525
• NCBI Accession ID: NC_016856.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
• Left: 4229041
• Right: 4229103
• Strand: -
• Nucleotide Sequence: GTGACTGGGGTAAGCGAAGGCAGCCAACGCAGCAGCAGCGTGAAAGGCGTCAGGAGTTTTTGA
• Sequence: VTGVSEGSQRSSSVKGVRSF
• Source of smORF: Ribo-seq
• Pubmed ID: 28122954
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 20

Conservation Analysis

No. of Species: 3

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4215470	4215532	-	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2	2017157	2017219	-	NZ_CP053416.1	Salmonella bongori
3	2169020	2169079	-	NC_012962.1	Photorhabdus asymbiotica

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_003197.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF04220.14	0.67	2	4474.5	opposite-strand	Der GTPase activator (YihI)
2	PF04055.23	0.67	2	2913	opposite-strand	Radical SAM superfamily
3	PF06969.18	0.67	2	2913	opposite-strand	HemN C-terminal domain
4	PF00158.28	0.67	2	1191.0	same-strand	Sigma-54 interaction domain
5	PF00072.26	0.67	2	1191.0	same-strand	Response regulator receiver domain
6	PF14532.8	0.67	2	1191.0	same-strand	Sigma-54 interaction domain
7	PF02954.21	0.67	2	1191.0	same-strand	Bacterial regulatory protein, Fis family
8	PF07728.16	0.67	2	1191.0	same-strand	AAA domain (dynein-related subfamily)
9	PF02518.28	0.67	2	133.0	same-strand	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
10	PF00512.27	0.67	2	133.0	same-strand	His Kinase A (phospho-acceptor) domain
11	PF00120.26	0.67	2	80.0	same-strand	Glutamine synthetase, catalytic domain
12	PF03951.21	0.67	2	80.0	same-strand	Glutamine synthetase, beta-Grasp domain
13	PF00009.29	0.67	2	1865.0	opposite-strand	Elongation factor Tu GTP binding domain
14	PF00679.26	0.67	2	1865.0	opposite-strand	Elongation factor G C-terminus
15	PF03144.27	0.67	2	1865.0	opposite-strand	Elongation factor Tu domain 2
16	PF01926.25	0.67	2	1865	opposite-strand	50S ribosome-binding GTPase