Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00522 |
NCBI Accession ID | NC_016856.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
Left | 4058930 |
Right | 4058968 |
Strand | - |
Nucleotide Sequence | GTGAGAAACAGAAGATCTCTTGCTCAGTTTAGGCTATGA |
Sequence | VRNRRSLAQFRL |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 28122954 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 12 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3428683 | 3428721 | + | NZ_CP038469.1 | Citrobacter tructae |
2 | 4045250 | 4045288 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
3 | 1854652 | 1854690 | - | NZ_CP053416.1 | Salmonella bongori |
4 | 3234444 | 3234482 | + | NZ_CP017279.1 | Enterobacter ludwigii |
5 | 4616125 | 4616163 | - | NZ_CP012871.1 | [Enterobacter] lignolyticus |
6 | 269 | 307 | + | NC_015968.1 | Enterobacter soli |
7 | 2581571 | 2581609 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
8 | 4848577 | 4848615 | + | NZ_CP009756.1 | Enterobacter cloacae |
9 | 140 | 178 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
10 | 3487402 | 3487440 | + | NZ_CP023529.1 | Lelliottia amnigena |
11 | 5111239 | 5111277 | + | NZ_CP043318.1 | Enterobacter chengduensis |
12 | 4710853 | 4710891 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
13 | 2448528 | 2448566 | - | NZ_AP019007.1 | Enterobacter oligotrophicus |
14 | 4670245 | 4670283 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
15 | 896808 | 896846 | + | NZ_CP020388.1 | Pluralibacter gergoviae |
16 | 48038 | 48076 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
17 | 3858485 | 3858523 | - | NZ_AP014857.1 | Escherichia albertii |
18 | 3883887 | 3883925 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
19 | 3868833 | 3868871 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
20 | 2890024 | 2890062 | + | NZ_CP057657.1 | Escherichia fergusonii |
21 | 4570946 | 4570984 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
22 | 4449795 | 4449833 | + | NZ_LR134340.1 | Escherichia marmotae |
23 | 4072935 | 4072973 | + | NZ_CP061527.1 | Shigella dysenteriae |
24 | 4770254 | 4770292 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF12631.9 | 0.91 | 21 | 2901.0 | opposite-strand | MnmE helical domain |
2 | PF10396.11 | 0.91 | 21 | 2901.0 | opposite-strand | GTP-binding protein TrmE N-terminus |
3 | PF01926.25 | 0.83 | 19 | 2903.0 | opposite-strand | 50S ribosome-binding GTPase |
4 | PF14849.8 | 0.91 | 21 | 1151.0 | opposite-strand | YidC periplasmic domain |
5 | PF02096.22 | 0.91 | 21 | 1151.0 | opposite-strand | 60Kd inner membrane protein |
6 | PF00825.20 | 0.78 | 18 | 601 | opposite-strand | Ribonuclease P |
7 | PF00308.20 | 0.78 | 18 | 158 | same-strand | Bacterial dnaA protein |
8 | PF08299.13 | 0.74 | 17 | 158.0 | same-strand | Bacterial dnaA protein helix-turn-helix |
9 | PF11638.10 | 0.87 | 20 | 158 | same-strand | DnaA N-terminal domain |
10 | PF00004.31 | 0.74 | 17 | 158.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
11 | PF02767.18 | 0.78 | 18 | 1564 | same-strand | DNA polymerase III beta subunit, central domain |
12 | PF00712.21 | 0.78 | 18 | 1564 | same-strand | DNA polymerase III beta subunit, N-terminal domain |
13 | PF02768.17 | 0.78 | 18 | 1564 | same-strand | DNA polymerase III beta subunit, C-terminal domain |
14 | PF02463.21 | 0.78 | 18 | 2667 | same-strand | RecF/RecN/SMC N terminal domain |
15 | PF00204.27 | 0.78 | 18 | 3769 | same-strand | DNA gyrase B |
16 | PF18053.3 | 0.78 | 18 | 3769 | same-strand | DNA gyrase B subunit insert domain |
17 | PF00986.23 | 0.78 | 18 | 3769 | same-strand | DNA gyrase B subunit, carboxyl terminus |
18 | PF02518.28 | 0.78 | 18 | 3769 | same-strand | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase |
19 | PF01751.24 | 0.78 | 18 | 3769 | same-strand | Toprim domain |