Result : EXP00522

Protein Information

• Protein name: EXP00522
• NCBI Accession ID: NC_016856.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
• Left: 4058930
• Right: 4058968
• Strand: -
• Nucleotide Sequence: GTGAGAAACAGAAGATCTCTTGCTCAGTTTAGGCTATGA
• Sequence: VRNRRSLAQFRL
• Source of smORF: Ribo-seq
• Pubmed ID: 28122954
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 12

Conservation Analysis

No. of Species: 23

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3428683	3428721	+	NZ_CP038469.1	Citrobacter tructae
2	4045250	4045288	-	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
3	1854652	1854690	-	NZ_CP053416.1	Salmonella bongori
4	3234444	3234482	+	NZ_CP017279.1	Enterobacter ludwigii
5	4616125	4616163	-	NZ_CP012871.1	[Enterobacter] lignolyticus
6	269	307	+	NC_015968.1	Enterobacter soli
7	2581571	2581609	-	NZ_CP025034.2	Enterobacter sp. SGAir0187
8	4848577	4848615	+	NZ_CP009756.1	Enterobacter cloacae
9	140	178	+	NZ_CP017184.1	Enterobacter roggenkampii
10	3487402	3487440	+	NZ_CP023529.1	Lelliottia amnigena
11	5111239	5111277	+	NZ_CP043318.1	Enterobacter chengduensis
12	4710853	4710891	+	NZ_CP027986.1	Enterobacter sichuanensis
13	2448528	2448566	-	NZ_AP019007.1	Enterobacter oligotrophicus
14	4670245	4670283	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
15	896808	896846	+	NZ_CP020388.1	Pluralibacter gergoviae
16	48038	48076	-	NC_009792.1	Citrobacter koseri ATCC BAA-895
17	3858485	3858523	-	NZ_AP014857.1	Escherichia albertii
18	3883887	3883925	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
19	3868833	3868871	+	NC_004337.2	Shigella flexneri 2a str. 301
20	2890024	2890062	+	NZ_CP057657.1	Escherichia fergusonii
21	4570946	4570984	+	NZ_CP054058.1	Scandinavium goeteborgense
22	4449795	4449833	+	NZ_LR134340.1	Escherichia marmotae
23	4072935	4072973	+	NZ_CP061527.1	Shigella dysenteriae
24	4770254	4770292	-	NZ_CP013990.1	Leclercia adecarboxylata

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NZ_CP038469.1

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF12631.9	0.91	21	2901.0	opposite-strand	MnmE helical domain
2	PF10396.11	0.91	21	2901.0	opposite-strand	GTP-binding protein TrmE N-terminus
3	PF01926.25	0.83	19	2903.0	opposite-strand	50S ribosome-binding GTPase
4	PF14849.8	0.91	21	1151.0	opposite-strand	YidC periplasmic domain
5	PF02096.22	0.91	21	1151.0	opposite-strand	60Kd inner membrane protein
6	PF00825.20	0.78	18	601	opposite-strand	Ribonuclease P
7	PF00308.20	0.78	18	158	same-strand	Bacterial dnaA protein
8	PF08299.13	0.74	17	158.0	same-strand	Bacterial dnaA protein helix-turn-helix
9	PF11638.10	0.87	20	158	same-strand	DnaA N-terminal domain
10	PF00004.31	0.74	17	158.0	same-strand	ATPase family associated with various cellular activities (AAA)
11	PF02767.18	0.78	18	1564	same-strand	DNA polymerase III beta subunit, central domain
12	PF00712.21	0.78	18	1564	same-strand	DNA polymerase III beta subunit, N-terminal domain
13	PF02768.17	0.78	18	1564	same-strand	DNA polymerase III beta subunit, C-terminal domain
14	PF02463.21	0.78	18	2667	same-strand	RecF/RecN/SMC N terminal domain
15	PF00204.27	0.78	18	3769	same-strand	DNA gyrase B
16	PF18053.3	0.78	18	3769	same-strand	DNA gyrase B subunit insert domain
17	PF00986.23	0.78	18	3769	same-strand	DNA gyrase B subunit, carboxyl terminus
18	PF02518.28	0.78	18	3769	same-strand	Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase
19	PF01751.24	0.78	18	3769	same-strand	Toprim domain