Result : EXP00518
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00518 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 3971348 |
| Right | 3971395 |
| Strand | - |
| Nucleotide Sequence | ATGAAACCTATCAGCCAAATGAAAGCGTTTCCGGGTAAAAGCCGCTGA |
| Sequence | MKPISQMKAFPGKSR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3957668 | 3957715 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1001420 | 1001467 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03797.21 | 1.0 | 2 | 28.0 | opposite-strand | Autotransporter beta-domain |
| 2 | PF18883.2 | 1.0 | 2 | 28.0 | opposite-strand | Autochaperone Domain Type 1 |
| 3 | PF03212.16 | 1.0 | 2 | 28.0 | opposite-strand | Pertactin |
| 4 | PF00486.30 | 1.0 | 2 | 495.0 | same-strand | Transcriptional regulatory protein, C terminal |
++ More..