Result : EXP00509
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00509 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 3026465 |
| Right | 3026527 |
| Strand | - |
| Nucleotide Sequence | ATGAAAATAATTCTTATTTGCGAAATGGCGACAATATGCAGTGATAGTGCTAAAGAGGGATAA |
| Sequence | MKIILICEMATICSDSAKEG |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3006234 | 3006296 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 827004 | 827066 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01455.20 | 1.0 | 2 | 4856.0 | opposite-strand | HupF/HypC family |
| 2 | PF01924.18 | 1.0 | 2 | 3735.0 | opposite-strand | Hydrogenase formation hypA family |
| 3 | PF02769.24 | 1.0 | 2 | 2728.0 | opposite-strand | AIR synthase related protein, C-terminal domain |
| 4 | PF00586.26 | 1.0 | 2 | 2728.0 | opposite-strand | AIR synthase related protein, N-terminal domain |
| 5 | PF00158.28 | 1.0 | 2 | 461.5 | opposite-strand | Sigma-54 interaction domain |
| 6 | PF14532.8 | 1.0 | 2 | 461.5 | opposite-strand | Sigma-54 interaction domain |
| 7 | PF01590.28 | 1.0 | 2 | 461.5 | opposite-strand | GAF domain |
| 8 | PF13492.8 | 1.0 | 2 | 461.5 | opposite-strand | GAF domain |
| 9 | PF13185.8 | 1.0 | 2 | 461.5 | opposite-strand | GAF domain |
| 10 | PF07728.16 | 1.0 | 2 | 461.5 | opposite-strand | AAA domain (dynein-related subfamily) |
| 11 | PF00004.31 | 1.0 | 2 | 461.5 | opposite-strand | ATPase family associated with various cellular activities (AAA) |
| 12 | PF02954.21 | 1.0 | 2 | 461.5 | opposite-strand | Bacterial regulatory protein, Fis family |
| 13 | PF11756.10 | 1.0 | 2 | 40.5 | same-strand | Nitrous oxide-stimulated promoter |
| 14 | PF01297.19 | 1.0 | 2 | 79.0 | opposite-strand | Zinc-uptake complex component A periplasmic |
| 15 | PF00005.29 | 1.0 | 2 | 993.0 | opposite-strand | ABC transporter |
| 16 | PF00950.19 | 1.0 | 2 | 2236.5 | opposite-strand | ABC 3 transport family |
| 17 | PF03421.18 | 1.0 | 2 | 3609.5 | same-strand | YopJ Serine/Threonine acetyltransferase |
++ More..