Result : EXP00505
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00505 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 1947387 |
| Right | 1947479 |
| Strand | - |
| Nucleotide Sequence | GTGAGGATATATCTTTCGCAATTTTGTTGCATAAACGTGCTGTCAATTTGTGAAGGTTCTCGTAATTTGTGCGACGGATCGAGACACGTTTAA |
| Sequence | VRIYLSQFCCINVLSICEGSRNLCDGSRHV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 30 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1935979 | 1936071 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 4446987 | 4447079 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06173.14 | 1.0 | 2 | 4243.0 | opposite-strand | Protein of unknown function (DUF986) |
| 2 | PF02659.17 | 1.0 | 2 | 3273.0 | opposite-strand | Putative manganese efflux pump |
| 3 | PF13649.8 | 1.0 | 2 | 2467.0 | same-strand | Methyltransferase domain |
| 4 | PF08241.14 | 1.0 | 2 | 2467.0 | same-strand | Methyltransferase domain |
| 5 | PF00905.24 | 1.0 | 2 | 655.5 | same-strand | Penicillin binding protein transpeptidase domain |
| 6 | PF03717.17 | 1.0 | 2 | 655.5 | same-strand | Penicillin-binding Protein dimerisation domain |
| 7 | PF00313.24 | 1.0 | 2 | 226.0 | same-strand | 'Cold-shock' DNA-binding domain |
| 8 | PF13974.8 | 1.0 | 2 | 491.0 | same-strand | YebO-like protein |
| 9 | PF13998.8 | 1.0 | 2 | 849.0 | same-strand | MgrB protein |
| 10 | PF13996.8 | 1.0 | 2 | 1150.0 | opposite-strand | YobH-like protein |
| 11 | PF01614.20 | 1.0 | 2 | 1598.5 | same-strand | Bacterial transcriptional regulator |
| 12 | PF09339.12 | 1.0 | 2 | 1598.5 | same-strand | IclR helix-turn-helix domain |
| 13 | PF13412.8 | 1.0 | 2 | 1598.5 | same-strand | Winged helix-turn-helix DNA-binding |
| 14 | PF07690.18 | 1.0 | 2 | 2565.5 | opposite-strand | Major Facilitator Superfamily |
++ More..