Result : EXP00496
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00496 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 1335693 |
| Right | 1335749 |
| Strand | - |
| Nucleotide Sequence | ATGACGATCGGGGTAAAGGATGAACTACTATTGCGGTCTGAATTGAGGGAGTTTTGA |
| Sequence | MTIGVKDELLLRSELREF |
| Source of smORF | Ribo-seq |
| Function | It is induced in SPI-2 , low Mg2+ conditions. (infection relevant conditions) Pubmed:Venturini_et_al_2020 |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Manually curated function from literature |
| Uniprot ID | |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1325708 | 1325764 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3712770 | 3712826 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF03054.18 | 1.0 | 2 | 2859.0 | same-strand | tRNA methyl transferase |
| 2 | PF00293.30 | 1.0 | 2 | 2344.0 | same-strand | NUDIX domain |
| 3 | PF00849.24 | 1.0 | 2 | 1439.0 | same-strand | RNA pseudouridylate synthase |
| 4 | PF00180.22 | 1.0 | 2 | 89.0 | opposite-strand | Isocitrate/isopropylmalate dehydrogenase |
++ More..