Result : EXP00493
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00493 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 4654493 |
| Right | 4654558 |
| Strand | + |
| Nucleotide Sequence | ATGAAAGCTATTATCAAAACCGCTGACGGTATCACAGTTGGCGGAACCCTTAACGATCGGGTATAA |
| Sequence | MKAIIKTADGITVGGTLNDRV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4641678 | 4641743 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2420707 | 2420772 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 3449328 | 3449393 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 4 | 3230931 | 3230996 | + | NZ_CP033744.1 | Citrobacter freundii |
| 5 | 1850176 | 1850241 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 6 | 2250387 | 2250458 | + | NZ_CP024848.1 | Oceanobacillus zhaokaii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00892.22 | 0.83 | 5 | 3580 | opposite-strand | EamA-like transporter family |
| 2 | PF05368.15 | 0.83 | 5 | 2592 | opposite-strand | NmrA-like family |
| 3 | PF13460.8 | 0.83 | 5 | 2592 | opposite-strand | NAD(P)H-binding |
| 4 | PF01638.19 | 0.83 | 5 | 2121 | same-strand | HxlR-like helix-turn-helix |
| 5 | PF02872.20 | 0.83 | 5 | 81 | opposite-strand | 5'-nucleotidase, C-terminal domain |
| 6 | PF00149.30 | 0.83 | 5 | 81 | opposite-strand | Calcineurin-like phosphoesterase |
| 7 | PF00459.27 | 0.83 | 5 | 44 | same-strand | Inositol monophosphatase family |
| 8 | PF09695.12 | 0.83 | 5 | 774 | opposite-strand | Bacterial protein of unknown function (YtfJ HI0045) |
| 9 | PF06526.14 | 0.83 | 5 | 1660 | same-strand | Protein of unknown function (DUF1107) |
| 10 | PF01595.22 | 0.83 | 5 | 1936 | opposite-strand | Cyclin M transmembrane N-terminal domain |
| 11 | PF03471.19 | 0.83 | 5 | 1936 | opposite-strand | Transporter associated domain |
++ More..