Result : EXP00489

Protein Information

• Protein name: EXP00489
• NCBI Accession ID: NC_016856.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
• Left: 4529456
• Right: 4529506
• Strand: +
• Nucleotide Sequence: TTGTCCAGGTTACTAACTCTAAAGTGGTATTTTACATACACTTACAATTGA
• Sequence: LSRLLTLKWYFTYTYN
• Source of smORF: Ribo-seq
• Pubmed ID: 28122954
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 16

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	4515930	4515980	+	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2	2265300	2265350	+	NZ_CP053416.1	Salmonella bongori

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_003197.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF03788.16	1.0	2	5120.5	same-strand	LrgA family
2	PF04172.18	1.0	2	4438.5	same-strand	LrgB-like family
3	PF00474.19	1.0	2	2752.0	opposite-strand	Sodium:solute symporter family
4	PF04341.14	1.0	2	2441.0	opposite-strand	Protein of unknown function, DUF485
5	PF00501.30	1.0	2	242.0	opposite-strand	AMP-binding enzyme
6	PF13193.8	1.0	2	242.0	opposite-strand	AMP-binding enzyme C-terminal domain
7	PF16177.7	1.0	2	242.0	opposite-strand	Acetyl-coenzyme A synthetase N-terminus