Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00487 |
NCBI Accession ID | NC_016856.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
Left | 4375412 |
Right | 4375510 |
Strand | + |
Nucleotide Sequence | TTGATGCCCTTTTTGCACGCTTTCACACCAGAACCTGGCTCATCAGTGATTTTATTTGTCATAATCATTGCTGAGACAGGCTCTGTAGAGGGCGTATAA |
Sequence | LMPFLHAFTPEPGSSVILFVIIIAETGSVEGV |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 28122954 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 32 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 4361844 | 4361942 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 2130808 | 2130906 | + | NZ_CP053416.1 | Salmonella bongori |
3 | 4986316 | 4986414 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
4 | 4149610 | 4149708 | + | NZ_AP014857.1 | Escherichia albertii |
5 | 4177172 | 4177270 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
6 | 4196924 | 4197022 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
7 | 3120205 | 3120303 | + | NZ_CP057657.1 | Escherichia fergusonii |
8 | 217183 | 217281 | + | NZ_LR134340.1 | Escherichia marmotae |
9 | 109679 | 109777 | + | NZ_CP061527.1 | Shigella dysenteriae |
10 | 3713730 | 3713828 | + | NZ_CP023529.1 | Lelliottia amnigena |
11 | 2942791 | 2942889 | + | NZ_CP033744.1 | Citrobacter freundii |
12 | 2128039 | 2128137 | - | NZ_CP044098.1 | Citrobacter portucalensis |
13 | 2790244 | 2790342 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
14 | 229091 | 229189 | + | NZ_CP043318.1 | Enterobacter chengduensis |
15 | 216604 | 216702 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
16 | 4326067 | 4326165 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
17 | 3441254 | 3441352 | + | NZ_CP017279.1 | Enterobacter ludwigii |
18 | 4430208 | 4430306 | - | NZ_CP045845.1 | Kluyvera intermedia |
19 | 200113 | 200211 | + | NZ_AP022508.1 | Enterobacter bugandensis |
20 | 3158507 | 3158605 | - | NZ_CP038469.1 | Citrobacter tructae |
21 | 242357 | 242455 | + | NZ_CP009756.1 | Enterobacter cloacae |
22 | 3323687 | 3323785 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
23 | 2388174 | 2388272 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
24 | 228100 | 228198 | + | NC_015968.1 | Enterobacter soli |
25 | 214257 | 214355 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
26 | 216349 | 216447 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
27 | 2714137 | 2714235 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00009.29 | 1.0 | 26 | 44 | same-strand | Elongation factor Tu GTP binding domain |
2 | PF03143.19 | 1.0 | 26 | 44 | same-strand | Elongation factor Tu C-terminal domain |
3 | PF03144.27 | 1.0 | 26 | 44 | same-strand | Elongation factor Tu domain 2 |
4 | PF01926.25 | 1.0 | 26 | 44 | same-strand | 50S ribosome-binding GTPase |
5 | PF00584.22 | 1.0 | 26 | 88 | same-strand | SecE/Sec61-gamma subunits of protein translocation complex |
6 | PF02357.21 | 1.0 | 26 | 473 | same-strand | Transcription termination factor nusG |
7 | PF00467.31 | 1.0 | 26 | 473 | same-strand | KOW motif |
8 | PF03946.16 | 1.0 | 26 | 1174 | same-strand | Ribosomal protein L11, N-terminal domain |
9 | PF00298.21 | 1.0 | 26 | 1174 | same-strand | Ribosomal protein L11, RNA binding domain |
10 | PF00687.23 | 1.0 | 26 | 1606 | same-strand | Ribosomal protein L1p/L10e family |
11 | PF00466.22 | 1.0 | 26 | 2605 | same-strand | Ribosomal protein L10 |