Result : EXP00487
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00487 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 4375412 |
| Right | 4375510 |
| Strand | + |
| Nucleotide Sequence | TTGATGCCCTTTTTGCACGCTTTCACACCAGAACCTGGCTCATCAGTGATTTTATTTGTCATAATCATTGCTGAGACAGGCTCTGTAGAGGGCGTATAA |
| Sequence | LMPFLHAFTPEPGSSVILFVIIIAETGSVEGV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 32 |
++ More..
| Conservation Analysis |
No. of Species: 26
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4361844 | 4361942 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2130808 | 2130906 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 4986316 | 4986414 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 4 | 4149610 | 4149708 | + | NZ_AP014857.1 | Escherichia albertii |
| 5 | 4177172 | 4177270 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 6 | 4196924 | 4197022 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 7 | 3120205 | 3120303 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 8 | 217183 | 217281 | + | NZ_LR134340.1 | Escherichia marmotae |
| 9 | 109679 | 109777 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 10 | 3713730 | 3713828 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 11 | 2942791 | 2942889 | + | NZ_CP033744.1 | Citrobacter freundii |
| 12 | 2128039 | 2128137 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 13 | 2790244 | 2790342 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 14 | 229091 | 229189 | + | NZ_CP043318.1 | Enterobacter chengduensis |
| 15 | 216604 | 216702 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 16 | 4326067 | 4326165 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 17 | 3441254 | 3441352 | + | NZ_CP017279.1 | Enterobacter ludwigii |
| 18 | 4430208 | 4430306 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 19 | 200113 | 200211 | + | NZ_AP022508.1 | Enterobacter bugandensis |
| 20 | 3158507 | 3158605 | - | NZ_CP038469.1 | Citrobacter tructae |
| 21 | 242357 | 242455 | + | NZ_CP009756.1 | Enterobacter cloacae |
| 22 | 3323687 | 3323785 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
| 23 | 2388174 | 2388272 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
| 24 | 228100 | 228198 | + | NC_015968.1 | Enterobacter soli |
| 25 | 214257 | 214355 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
| 26 | 216349 | 216447 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
| 27 | 2714137 | 2714235 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00009.29 | 1.0 | 26 | 44 | same-strand | Elongation factor Tu GTP binding domain |
| 2 | PF03143.19 | 1.0 | 26 | 44 | same-strand | Elongation factor Tu C-terminal domain |
| 3 | PF03144.27 | 1.0 | 26 | 44 | same-strand | Elongation factor Tu domain 2 |
| 4 | PF01926.25 | 1.0 | 26 | 44 | same-strand | 50S ribosome-binding GTPase |
| 5 | PF00584.22 | 1.0 | 26 | 88 | same-strand | SecE/Sec61-gamma subunits of protein translocation complex |
| 6 | PF02357.21 | 1.0 | 26 | 473 | same-strand | Transcription termination factor nusG |
| 7 | PF00467.31 | 1.0 | 26 | 473 | same-strand | KOW motif |
| 8 | PF03946.16 | 1.0 | 26 | 1174 | same-strand | Ribosomal protein L11, N-terminal domain |
| 9 | PF00298.21 | 1.0 | 26 | 1174 | same-strand | Ribosomal protein L11, RNA binding domain |
| 10 | PF00687.23 | 1.0 | 26 | 1606 | same-strand | Ribosomal protein L1p/L10e family |
| 11 | PF00466.22 | 1.0 | 26 | 2605 | same-strand | Ribosomal protein L10 |
++ More..