Result : EXP00486
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00486 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 4171723 |
| Right | 4171791 |
| Strand | + |
| Nucleotide Sequence | TTGCTGATAGCCTTAGCGGTTGTCAGCGACCTTTCATTTTTTCCCGTCGCGTTGAGTCAGGCTGTTTAA |
| Sequence | LLIALAVVSDLSFFPVALSQAV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4158045 | 4158113 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1103061 | 1103129 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 3 | 570828 | 570896 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 4 | 2317275 | 2317343 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 5 | 3327788 | 3327856 | - | NZ_CP038469.1 | Citrobacter tructae |
| 6 | 3666735 | 3666800 | - | NZ_CP029185.2 | Limnobaculum parvum |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LT556085.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01678.21 | 1.0 | 6 | 4863.5 | same-strand | Diaminopimelate epimerase |
| 2 | PF04340.14 | 1.0 | 6 | 4159.5 | same-strand | Protein of unknown function, DUF484 |
| 3 | PF00589.24 | 1.0 | 6 | 3251.5 | same-strand | Phage integrase family |
| 4 | PF02899.19 | 1.0 | 6 | 3251.5 | same-strand | Phage integrase, N-terminal SAM-like domain |
| 5 | PF13419.8 | 1.0 | 6 | 2535.5 | same-strand | Haloacid dehalogenase-like hydrolase |
| 6 | PF00702.28 | 1.0 | 6 | 2535.5 | same-strand | haloacid dehalogenase-like hydrolase |
| 7 | PF13361.8 | 1.0 | 6 | 267.5 | same-strand | UvrD-like helicase C-terminal domain |
| 8 | PF00580.23 | 1.0 | 6 | 267.5 | same-strand | UvrD/REP helicase N-terminal domain |
| 9 | PF13245.8 | 1.0 | 6 | 267.5 | same-strand | AAA domain |
| 10 | PF13538.8 | 1.0 | 6 | 267.5 | same-strand | UvrD-like helicase C-terminal domain |
| 11 | PF01544.20 | 1.0 | 6 | 74.0 | same-strand | CorA-like Mg2+ transporter protein |
| 12 | PF00892.22 | 1.0 | 6 | 1379.0 | opposite-strand | EamA-like transporter family |
| 13 | PF03061.24 | 0.83 | 5 | 2054 | opposite-strand | Thioesterase superfamily |
| 14 | PF09382.12 | 0.67 | 4 | 3635.0 | same-strand | RQC domain |
| 15 | PF00271.33 | 0.67 | 4 | 3635.0 | same-strand | Helicase conserved C-terminal domain |
| 16 | PF00570.25 | 0.67 | 4 | 3635.0 | same-strand | HRDC domain |
| 17 | PF00270.31 | 0.67 | 4 | 3635.0 | same-strand | DEAD/DEAH box helicase |
| 18 | PF16124.7 | 0.67 | 4 | 3635.0 | same-strand | RecQ zinc-binding |
| 19 | PF02253.17 | 0.67 | 4 | 2681.0 | same-strand | Phospholipase A1 |
++ More..