Result : EXP00485
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00485 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 4171654 |
| Right | 4171710 |
| Strand | + |
| Nucleotide Sequence | TTGGACACACCCAGTAGATACTGGCTCATTATCCTGTCATCCAGGATCAACTCCTAA |
| Sequence | LDTPSRYWLIILSSRINS |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed at high levels equally in exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSH7 |
| ORF Length (Amino Acid) | 18 |
++ More..
| Conservation Analysis |
No. of Species: 65
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 570759 | 570815 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 2 | 1103142 | 1103198 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 3 | 2772666 | 2772722 | + | NZ_CP033744.1 | Citrobacter freundii |
| 4 | 2317356 | 2317412 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 5 | 4157976 | 4158032 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 6 | 3327869 | 3327925 | - | NZ_CP038469.1 | Citrobacter tructae |
| 7 | 1962767 | 1962823 | + | NZ_CP053416.1 | Salmonella bongori |
| 8 | 4795886 | 4795942 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 9 | 4158414 | 4158470 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 10 | 3972128 | 3972184 | + | NZ_AP014857.1 | Escherichia albertii |
| 11 | 4001218 | 4001274 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 12 | 4014361 | 4014417 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 13 | 4342126 | 4342182 | - | NZ_LR134340.1 | Escherichia marmotae |
| 14 | 4333034 | 4333090 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 15 | 2770632 | 2770688 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 16 | 150384 | 150440 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 17 | 170527 | 170583 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 18 | 4570101 | 4570157 | - | NC_015968.1 | Enterobacter soli |
| 19 | 231938 | 231994 | + | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 20 | 248066 | 248122 | + | NC_014306.1 | Erwinia billingiae Eb661 |
| 21 | 3756311 | 3756367 | - | NZ_CP023567.1 | Erwinia pyrifoliae |
| 22 | 4473936 | 4473992 | - | NZ_CP045845.1 | Kluyvera intermedia |
| 23 | 4317149 | 4317205 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 24 | 1456266 | 1456322 | + | NZ_CP040428.1 | Jejubacter calystegiae |
| 25 | 2115346 | 2115402 | + | NZ_CP011254.1 | Serratia fonticola |
| 26 | 5199992 | 5200048 | - | NZ_CP014007.2 | Kosakonia oryzae |
| 27 | 2952439 | 2952495 | - | NZ_CP045300.1 | Kosakonia arachidis |
| 28 | 5526910 | 5526966 | + | NZ_CP015113.1 | Kosakonia radicincitans |
| 29 | 4429697 | 4429753 | - | NZ_LR134201.1 | Cedecea lapagei |
| 30 | 298868 | 298924 | + | NZ_CP012266.1 | Cronobacter dublinensis subsp. dublinensis LMG 23823 |
| 31 | 304817 | 304873 | + | NZ_CP012264.1 | Cronobacter condimenti 1330 |
| 32 | 836772 | 836828 | - | NZ_CP023009.1 | Lonsdalea britannica |
| 33 | 684106 | 684162 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 34 | 184038 | 184094 | + | NZ_CP063425.1 | Kosakonia pseudosacchari |
| 35 | 3337378 | 3337434 | + | NZ_CP016337.1 | Kosakonia sacchari |
| 36 | 3593881 | 3593937 | - | NZ_LN907827.1 | Erwinia gerundensis |
| 37 | 158248 | 158304 | + | NZ_CP038662.1 | Serratia nematodiphila |
| 38 | 4645302 | 4645358 | + | NZ_CP016948.1 | Serratia surfactantfaciens |
| 39 | 4874367 | 4874423 | - | NZ_CP071320.1 | Serratia ureilytica |
| 40 | 1486031 | 1486087 | - | NZ_CP042941.1 | Atlantibacter hermannii |
| 41 | 3739222 | 3739278 | - | NZ_CP012268.1 | Cronobacter muytjensii ATCC 51329 |
| 42 | 289844 | 289900 | + | NZ_CP012257.1 | Cronobacter universalis NCTC 9529 |
| 43 | 3862129 | 3862185 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
| 44 | 3141602 | 3141658 | - | NZ_CP027107.1 | Cronobacter sakazakii |
| 45 | 232082 | 232138 | + | NZ_CP065534.1 | Lonsdalea populi |
| 46 | 4373365 | 4373421 | - | NZ_CP054058.1 | Scandinavium goeteborgense |
| 47 | 4853826 | 4853882 | - | NZ_CP023525.1 | Cedecea neteri |
| 48 | 5392637 | 5392693 | - | NZ_CP050508.1 | Raoultella terrigena |
| 49 | 5370681 | 5370737 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
| 50 | 1941233 | 1941289 | + | NZ_CP026047.1 | Raoultella planticola |
| 51 | 5323515 | 5323571 | - | NZ_CP054254.1 | Klebsiella variicola |
| 52 | 178246 | 178302 | + | NC_016845.1 | Klebsiella pneumoniae subsp. pneumoniae HS11286 |
| 53 | 5034023 | 5034079 | - | NZ_CP065838.1 | Klebsiella quasipneumoniae |
| 54 | 5082100 | 5082156 | - | NZ_LR134475.1 | Klebsiella aerogenes |
| 55 | 5072215 | 5072271 | - | NZ_CP041247.1 | Raoultella electrica |
| 56 | 264477 | 264533 | + | NC_010694.1 | Erwinia tasmaniensis Et1/99 |
| 57 | 5916328 | 5916384 | - | NZ_CP036175.1 | Klebsiella huaxiensis |
| 58 | 1315056 | 1315112 | - | NZ_CP015750.1 | Pectobacterium wasabiae CFBP 3304 |
| 59 | 4556769 | 4556825 | + | NZ_CP015749.1 | Pectobacterium parmentieri |
| 60 | 3383216 | 3383272 | - | NZ_CP017482.1 | Pectobacterium polaris |
| 61 | 4560645 | 4560701 | - | NZ_CP034938.1 | Pectobacterium odoriferum |
| 62 | 332255 | 332311 | + | NZ_CP065044.1 | Pectobacterium aroidearum |
| 63 | 4574637 | 4574693 | - | NZ_CP009125.1 | Pectobacterium atrosepticum |
| 64 | 313945 | 314001 | + | NZ_CP051652.1 | Pectobacterium carotovorum |
| 65 | 1966560 | 1966616 | + | NZ_CP047495.1 | Pectobacterium brasiliense |
| 66 | 4416085 | 4416141 | - | NZ_CP038498.1 | Pectobacterium punjabense |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP045205.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01678.21 | 0.71 | 46 | 4709.0 | same-strand | Diaminopimelate epimerase |
| 2 | PF04340.14 | 0.92 | 60 | 4010.5 | same-strand | Protein of unknown function, DUF484 |
| 3 | PF00589.24 | 0.98 | 64 | 3165 | same-strand | Phage integrase family |
| 4 | PF02899.19 | 0.98 | 64 | 3165 | same-strand | Phage integrase, N-terminal SAM-like domain |
| 5 | PF13419.8 | 0.98 | 64 | 2449 | same-strand | Haloacid dehalogenase-like hydrolase |
| 6 | PF00702.28 | 1.0 | 65 | 2449.5 | same-strand | haloacid dehalogenase-like hydrolase |
| 7 | PF13361.8 | 1.0 | 65 | 150.0 | same-strand | UvrD-like helicase C-terminal domain |
| 8 | PF00580.23 | 1.0 | 65 | 150.0 | same-strand | UvrD/REP helicase N-terminal domain |
| 9 | PF13245.8 | 1.0 | 65 | 150.0 | same-strand | AAA domain |
| 10 | PF13538.8 | 1.0 | 65 | 150.0 | same-strand | UvrD-like helicase C-terminal domain |
| 11 | PF01544.20 | 1.0 | 65 | 153.0 | same-strand | CorA-like Mg2+ transporter protein |
| 12 | PF00892.22 | 0.94 | 61 | 2014.5 | opposite-strand | EamA-like transporter family |
| 13 | PF03061.24 | 0.94 | 61 | 2956 | opposite-strand | Thioesterase superfamily |
| 14 | PF02253.17 | 0.71 | 46 | 2764.0 | same-strand | Phospholipase A1 |
++ More..