Result : EXP00483
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00483 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 4159777 |
| Right | 4159827 |
| Strand | + |
| Nucleotide Sequence | GTGTCGTCAATGACAGTGAATAATGACGAGAAACCGCCAGCCCGTATTTAA |
| Sequence | VSSMTVNNDEKPPARI |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4146099 | 4146149 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1953394 | 1953444 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00324.23 | 1.0 | 2 | 5290.5 | same-strand | Amino acid permease |
| 2 | PF13520.8 | 1.0 | 2 | 5290.5 | same-strand | Amino acid permease |
| 3 | PF07219.15 | 1.0 | 2 | 2971.0 | opposite-strand | HemY protein N-terminus |
| 4 | PF07719.19 | 1.0 | 2 | 2971.0 | opposite-strand | Tetratricopeptide repeat |
| 5 | PF04375.16 | 1.0 | 2 | 1796.0 | opposite-strand | HemX, putative uroporphyrinogen-III C-methyltransferase |
| 6 | PF02602.17 | 1.0 | 2 | 1034.0 | opposite-strand | Uroporphyrinogen-III synthase HemD |
| 7 | PF01379.22 | 1.0 | 2 | 75.0 | opposite-strand | Porphobilinogen deaminase, dipyromethane cofactor binding domain |
| 8 | PF03900.17 | 1.0 | 2 | 75.0 | opposite-strand | Porphobilinogen deaminase, C-terminal domain |
| 9 | PF01295.20 | 1.0 | 2 | 231.0 | same-strand | Adenylate cyclase, class-I |
| 10 | PF12633.9 | 1.0 | 2 | 231.0 | same-strand | Adenylate cyclase NT domain |
| 11 | PF01491.18 | 1.0 | 2 | 3633.0 | opposite-strand | Frataxin-like domain |
++ More..