Result : EXP00481
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00481 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 4122611 |
| Right | 4122661 |
| Strand | + |
| Nucleotide Sequence | GTGAATAACAGCATAAAATTCTGTTTCTCAAGATTTACGACGGGGATGTAA |
| Sequence | VNNSIKFCFSRFTTGM |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: In stationary phase (Pubmed:19121005) and in minimal glucose or glycerol medium (Pubmed:19734316) (at protein level) Pubmed:19121005,19734316 |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | C1P619 |
| ORF Length (Amino Acid) | 16 |
++ More..
| Conservation Analysis |
No. of Species: 21
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4108933 | 4108983 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1914426 | 1914476 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 2725788 | 2725838 | + | NZ_CP033744.1 | Citrobacter freundii |
| 4 | 2364443 | 2364493 | - | NZ_CP044098.1 | Citrobacter portucalensis |
| 5 | 3371060 | 3371110 | - | NZ_CP038469.1 | Citrobacter tructae |
| 6 | 512441 | 512491 | + | NZ_CP045205.1 | Citrobacter telavivensis |
| 7 | 4526389 | 4526439 | - | NZ_CP035129.1 | Kosakonia cowanii |
| 8 | 3917627 | 3917677 | + | NZ_AP014857.1 | Escherichia albertii |
| 9 | 3950507 | 3950557 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 10 | 2823686 | 2823736 | - | NZ_CP057657.1 | Escherichia fergusonii |
| 11 | 4279502 | 4279552 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 12 | 4393753 | 4393803 | - | NZ_LR134340.1 | Escherichia marmotae |
| 13 | 3959947 | 3959997 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 14 | 1160290 | 1160340 | - | NZ_LT556085.1 | Citrobacter amalonaticus |
| 15 | 4744077 | 4744127 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 16 | 5437328 | 5437378 | - | NZ_CP050508.1 | Raoultella terrigena |
| 17 | 172569 | 172619 | + | NZ_CP013990.1 | Leclercia adecarboxylata |
| 18 | 4678418 | 4678468 | - | NZ_CP009756.1 | Enterobacter cloacae |
| 19 | 4558796 | 4558846 | - | NZ_CP027986.1 | Enterobacter sichuanensis |
| 20 | 11544 | 11594 | + | NZ_CP017280.1 | Enterobacter ludwigii |
| 21 | 4208075 | 4208125 | - | NC_013716.1 | Citrobacter rodentium ICC168 |
| 22 | 5414887 | 5414937 | - | NZ_CP046672.1 | Raoultella ornithinolytica |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00126.29 | 0.95 | 20 | 2540 | opposite-strand | Bacterial regulatory helix-turn-helix protein, lysR family |
| 2 | PF03466.22 | 0.9 | 19 | 2540.0 | opposite-strand | LysR substrate binding domain |
| 3 | PF04219.14 | 0.95 | 20 | 2083 | same-strand | Protein of unknown function, DUF |
| 4 | PF01078.23 | 1.0 | 21 | 538.0 | opposite-strand | Magnesium chelatase, subunit ChlI |
| 5 | PF13541.8 | 0.95 | 20 | 538 | opposite-strand | Subunit ChlI of Mg-chelatase |
| 6 | PF13335.8 | 1.0 | 21 | 538.0 | opposite-strand | Magnesium chelatase, subunit ChlI C-terminal |
| 7 | PF07728.16 | 1.0 | 21 | 538.0 | opposite-strand | AAA domain (dynein-related subfamily) |
| 8 | PF02776.20 | 1.0 | 21 | 3.0 | same-strand | Thiamine pyrophosphate enzyme, N-terminal TPP binding domain |
| 9 | PF02775.23 | 1.0 | 21 | 3.0 | same-strand | Thiamine pyrophosphate enzyme, C-terminal TPP binding domain |
| 10 | PF00205.24 | 1.0 | 21 | 3.0 | same-strand | Thiamine pyrophosphate enzyme, central domain |
| 11 | PF13710.8 | 1.0 | 21 | 1646.0 | same-strand | ACT domain |
| 12 | PF13291.8 | 0.95 | 20 | 1646 | same-strand | ACT domain |
| 13 | PF01063.21 | 1.0 | 21 | 1928.0 | same-strand | Amino-transferase class IV |
| 14 | PF00920.23 | 1.0 | 21 | 2922.5 | same-strand | Dehydratase family |
| 15 | PF00291.27 | 1.0 | 21 | 4775 | same-strand | Pyridoxal-phosphate dependent enzyme |
| 16 | PF00585.20 | 1.0 | 21 | 4775 | same-strand | C-terminal regulatory domain of Threonine dehydratase |
++ More..