Result : EXP00478
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00478 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 3663976 |
| Right | 3664047 |
| Strand | + |
| Nucleotide Sequence | ATGCTCAAGTTCAACTCCACGCTTGCCGATAGCCAACCACAGAAAAATGTTTATTGGACAGGGTGCGACTGA |
| Sequence | MLKFNSTLADSQPQKNVYWTGCD |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 6
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3650089 | 3650160 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1499224 | 1499295 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 4418944 | 4419015 | + | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 4 | 4009850 | 4009921 | + | NZ_LR134340.1 | Escherichia marmotae |
| 5 | 3052884 | 3052955 | + | NZ_CP023529.1 | Lelliottia amnigena |
| 6 | 4454271 | 4454330 | + | NZ_CP009756.1 | Enterobacter cloacae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00912.24 | 1.0 | 6 | 876.0 | same-strand | Transglycosylase |
| 2 | PF17092.7 | 1.0 | 6 | 876.0 | same-strand | Penicillin-binding protein OB-like domain |
| 3 | PF00293.30 | 1.0 | 6 | 216.5 | opposite-strand | NUDIX domain |
| 4 | PF07095.13 | 1.0 | 6 | 35.0 | same-strand | Intracellular growth attenuator protein IgaA |
| 5 | PF13419.8 | 1.0 | 6 | 2235.5 | same-strand | Haloacid dehalogenase-like hydrolase |
| 6 | PF01479.27 | 1.0 | 6 | 2915.0 | same-strand | S4 domain |
| 7 | PF01430.21 | 1.0 | 6 | 3340.5 | same-strand | Hsp33 protein |
| 8 | PF13687.8 | 0.83 | 5 | 4315 | opposite-strand | Domain of unknown function (DUF4153) |
++ More..