Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00477 |
NCBI Accession ID | NC_016856.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
Left | 3563785 |
Right | 3563853 |
Strand | + |
Nucleotide Sequence | ATGAAGGTATATTTTGTTTTTTGCCCGAAAATGGCAGAAGATAGCCACACAATGACTGGCAAATCATGA |
Sequence | MKVYFVFCPKMAEDSHTMTGKS |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 28122954 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 22 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3549893 | 3549961 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 3874849 | 3874917 | - | NZ_CP038469.1 | Citrobacter tructae |
3 | 2206295 | 2206375 | + | NZ_CP033744.1 | Citrobacter freundii |
4 | 2876505 | 2876585 | - | NZ_CP044098.1 | Citrobacter portucalensis |
5 | 5426193 | 5426273 | + | NZ_CP045205.1 | Citrobacter telavivensis |
6 | 3293279 | 3293359 | + | NZ_CP032382.1 | Chryseolinea soli |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF06723.15 | 0.83 | 5 | 5327 | opposite-strand | MreB/Mbl protein |
2 | PF14450.8 | 0.83 | 5 | 5327 | opposite-strand | Cell division protein FtsA |
3 | PF00563.22 | 0.83 | 5 | 3079 | opposite-strand | EAL domain |
4 | PF17157.6 | 0.83 | 5 | 3079 | opposite-strand | Gammaproteobacterial periplasmic sensor domain |
5 | PF00990.23 | 0.83 | 5 | 3079 | opposite-strand | Diguanylate cyclase, GGDEF domain |
6 | PF00107.28 | 0.83 | 5 | 1901 | same-strand | Zinc-binding dehydrogenase |
7 | PF00174.21 | 0.83 | 5 | 784 | same-strand | Oxidoreductase molybdopterin binding domain |
8 | PF01794.21 | 0.83 | 5 | 184 | same-strand | Ferric reductase like transmembrane component |
9 | PF00364.24 | 0.83 | 5 | 129 | same-strand | Biotin-requiring enzyme |
10 | PF02786.19 | 0.83 | 5 | 610 | same-strand | Carbamoyl-phosphate synthase L chain, ATP binding domain |
11 | PF00289.24 | 0.83 | 5 | 610 | same-strand | Biotin carboxylase, N-terminal domain |
12 | PF02785.21 | 0.83 | 5 | 610 | same-strand | Biotin carboxylase C-terminal domain |
13 | PF02655.16 | 0.83 | 5 | 610 | same-strand | ATP-grasp domain |
14 | PF02222.24 | 0.83 | 5 | 610 | same-strand | ATP-grasp domain |
15 | PF06196.14 | 0.83 | 5 | 2067 | same-strand | Protein of unknown function (DUF997) |
16 | PF00474.19 | 0.83 | 5 | 2299 | same-strand | Sodium:solute symporter family |
17 | PF06325.15 | 0.83 | 5 | 3762 | same-strand | Ribosomal protein L11 methyltransferase (PrmA) |