Result : EXP00477

Protein Information

• Protein name: EXP00477
• NCBI Accession ID: NC_016856.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
• Left: 3563785
• Right: 3563853
• Strand: +
• Nucleotide Sequence: ATGAAGGTATATTTTGTTTTTTGCCCGAAAATGGCAGAAGATAGCCACACAATGACTGGCAAATCATGA
• Sequence: MKVYFVFCPKMAEDSHTMTGKS
• Source of smORF: Ribo-seq
• Pubmed ID: 28122954
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 22

Conservation Analysis

No. of Species: 6

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	3549893	3549961	+	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2	3874849	3874917	-	NZ_CP038469.1	Citrobacter tructae
3	2206295	2206375	+	NZ_CP033744.1	Citrobacter freundii
4	2876505	2876585	-	NZ_CP044098.1	Citrobacter portucalensis
5	5426193	5426273	+	NZ_CP045205.1	Citrobacter telavivensis
6	3293279	3293359	+	NZ_CP032382.1	Chryseolinea soli

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_003197.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF06723.15	0.83	5	5327	opposite-strand	MreB/Mbl protein
2	PF14450.8	0.83	5	5327	opposite-strand	Cell division protein FtsA
3	PF00563.22	0.83	5	3079	opposite-strand	EAL domain
4	PF17157.6	0.83	5	3079	opposite-strand	Gammaproteobacterial periplasmic sensor domain
5	PF00990.23	0.83	5	3079	opposite-strand	Diguanylate cyclase, GGDEF domain
6	PF00107.28	0.83	5	1901	same-strand	Zinc-binding dehydrogenase
7	PF00174.21	0.83	5	784	same-strand	Oxidoreductase molybdopterin binding domain
8	PF01794.21	0.83	5	184	same-strand	Ferric reductase like transmembrane component
9	PF00364.24	0.83	5	129	same-strand	Biotin-requiring enzyme
10	PF02786.19	0.83	5	610	same-strand	Carbamoyl-phosphate synthase L chain, ATP binding domain
11	PF00289.24	0.83	5	610	same-strand	Biotin carboxylase, N-terminal domain
12	PF02785.21	0.83	5	610	same-strand	Biotin carboxylase C-terminal domain
13	PF02655.16	0.83	5	610	same-strand	ATP-grasp domain
14	PF02222.24	0.83	5	610	same-strand	ATP-grasp domain
15	PF06196.14	0.83	5	2067	same-strand	Protein of unknown function (DUF997)
16	PF00474.19	0.83	5	2299	same-strand	Sodium:solute symporter family
17	PF06325.15	0.83	5	3762	same-strand	Ribosomal protein L11 methyltransferase (PrmA)