Result : EXP00470
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00470 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 3070223 |
| Right | 3070318 |
| Strand | + |
| Nucleotide Sequence | GTGGTCATCGAAAACAGTGTAGAGTTTTTGAGCTGGGTTAGCTTCGAAAACGATTTTTCCAGAGCGACTGAGTGCAGGCTTAACATTGATACTTAA |
| Sequence | VVIENSVEFLSWVSFENDFSRATECRLNIDT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 31 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 3049993 | 3050088 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 4413111 | 4413206 | - | NZ_CP038469.1 | Citrobacter tructae |
| 3 | 856236 | 856331 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
| 4 | 4222058 | 4222153 | + | NZ_CP071320.1 | Serratia ureilytica |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00488.23 | 1.0 | 4 | 198.0 | same-strand | MutS domain V |
| 2 | PF01624.22 | 1.0 | 4 | 198.0 | same-strand | MutS domain I |
| 3 | PF05192.20 | 1.0 | 4 | 198.0 | same-strand | MutS domain III |
| 4 | PF05188.19 | 1.0 | 4 | 198.0 | same-strand | MutS domain II |
| 5 | PF05190.20 | 1.0 | 4 | 198.0 | same-strand | MutS family domain IV |
++ More..