Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00470 |
NCBI Accession ID | NC_016856.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
Left | 3070223 |
Right | 3070318 |
Strand | + |
Nucleotide Sequence | GTGGTCATCGAAAACAGTGTAGAGTTTTTGAGCTGGGTTAGCTTCGAAAACGATTTTTCCAGAGCGACTGAGTGCAGGCTTAACATTGATACTTAA |
Sequence | VVIENSVEFLSWVSFENDFSRATECRLNIDT |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 28122954 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 31 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 3049993 | 3050088 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 4413111 | 4413206 | - | NZ_CP038469.1 | Citrobacter tructae |
3 | 856236 | 856331 | - | NC_013961.1 | Erwinia amylovora CFBP1430 |
4 | 4222058 | 4222153 | + | NZ_CP071320.1 | Serratia ureilytica |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00488.23 | 1.0 | 4 | 198.0 | same-strand | MutS domain V |
2 | PF01624.22 | 1.0 | 4 | 198.0 | same-strand | MutS domain I |
3 | PF05192.20 | 1.0 | 4 | 198.0 | same-strand | MutS domain III |
4 | PF05188.19 | 1.0 | 4 | 198.0 | same-strand | MutS domain II |
5 | PF05190.20 | 1.0 | 4 | 198.0 | same-strand | MutS family domain IV |