Result : EXP00451

Protein Information

• Protein name: EXP00451
• NCBI Accession ID: NC_016856.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
• Left: 1764133
• Right: 1764198
• Strand: +
• Nucleotide Sequence: ATGAAGGCTATCTTTTATTATGAATATACAGGCAAAAAGTGCCTTATCGGTCACACTTTTATGTAA
• Sequence: MKAIFYYEYTGKKCLIGHTFM
• Source of smORF: Ribo-seq
• Pubmed ID: 28122954
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 21

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1754150	1754215	+	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2	4167831	4167896	+	NZ_CP053416.1	Salmonella bongori

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_003197.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00270.31	1.0	2	4516.5	opposite-strand	DEAD/DEAH box helicase
2	PF00271.33	1.0	2	4516.5	opposite-strand	Helicase conserved C-terminal domain
3	PF03880.17	1.0	2	4516.5	opposite-strand	DbpA RNA binding domain
4	PF04851.17	1.0	2	4516.5	opposite-strand	Type III restriction enzyme, res subunit
5	PF01544.20	1.0	2	3046.0	opposite-strand	CorA-like Mg2+ transporter protein
6	PF00015.23	1.0	2	1739.5	opposite-strand	Methyl-accepting chemotaxis protein (MCP) signalling domain
7	PF01713.23	1.0	2	764.0	opposite-strand	Smr domain
8	PF01035.22	1.0	2	-22.0	same-strand	6-O-methylguanine DNA methyltransferase, DNA binding domain
9	PF02870.17	1.0	2	-22.0	same-strand	6-O-methylguanine DNA methyltransferase, ribonuclease-like domain
10	PF00325.22	1.0	2	153.0	same-strand	Bacterial regulatory proteins, crp family
11	PF13545.8	1.0	2	153.0	same-strand	Crp-like helix-turn-helix domain
12	PF00027.31	1.0	2	153.0	same-strand	Cyclic nucleotide-binding domain
13	PF00582.28	1.0	2	1056.5	same-strand	Universal stress protein family
14	PF10749.11	1.0	2	2056.5	opposite-strand	Protein of unknown function (DUF2534)
15	PF00924.20	1.0	2	2552.5	same-strand	Mechanosensitive ion channel
16	PF07883.13	1.0	2	3674.0	opposite-strand	Cupin domain