Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00450 |
NCBI Accession ID | NC_016856.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
Left | 1757190 |
Right | 1757234 |
Strand | + |
Nucleotide Sequence | ATGAACGACGAACAAGTAGCGATGTTGAATGCGCGGTTATCGTAA |
Sequence | MNDEQVAMLNARLS |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 28122954 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 14 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1921609 | 1921653 | - | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
2 | 1412000 | 1412044 | - | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
3 | 2345992 | 2346036 | + | NZ_LR134340.1 | Escherichia marmotae |
4 | 4160845 | 4160889 | + | NZ_CP053416.1 | Salmonella bongori |
5 | 1409241 | 1409285 | - | NC_004337.2 | Shigella flexneri 2a str. 301 |
6 | 1452575 | 1452619 | - | NZ_AP014857.1 | Escherichia albertii |
7 | 1747207 | 1747251 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
8 | 2289773 | 2289817 | + | NZ_CP061527.1 | Shigella dysenteriae |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF01544.20 | 0.86 | 6 | 2933 | opposite-strand | CorA-like Mg2+ transporter protein |
2 | PF00270.31 | 0.71 | 5 | 1086.0 | opposite-strand | DEAD/DEAH box helicase |
3 | PF00271.33 | 0.86 | 6 | 1090 | opposite-strand | Helicase conserved C-terminal domain |
4 | PF03880.17 | 0.86 | 6 | 1090 | opposite-strand | DbpA RNA binding domain |
5 | PF04851.17 | 0.71 | 5 | 1086.0 | opposite-strand | Type III restriction enzyme, res subunit |
6 | PF01171.22 | 0.86 | 6 | 52 | same-strand | PP-loop family |