Result : EXP00450

Protein Information

• Protein name: EXP00450
• NCBI Accession ID: NC_016856.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
• Left: 1757190
• Right: 1757234
• Strand: +
• Nucleotide Sequence: ATGAACGACGAACAAGTAGCGATGTTGAATGCGCGGTTATCGTAA
• Sequence: MNDEQVAMLNARLS
• Source of smORF: Ribo-seq
• Pubmed ID: 28122954
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 14

Conservation Analysis

No. of Species: 7

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	1921609	1921653	-	NC_002695.2	Escherichia coli O157:H7 str. Sakai
2	1412000	1412044	-	NC_000913.3	Escherichia coli str. K-12 substr. MG1655
3	2345992	2346036	+	NZ_LR134340.1	Escherichia marmotae
4	4160845	4160889	+	NZ_CP053416.1	Salmonella bongori
5	1409241	1409285	-	NC_004337.2	Shigella flexneri 2a str. 301
6	1452575	1452619	-	NZ_AP014857.1	Escherichia albertii
7	1747207	1747251	+	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
8	2289773	2289817	+	NZ_CP061527.1	Shigella dysenteriae

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_002695.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF01544.20	0.86	6	2933	opposite-strand	CorA-like Mg2+ transporter protein
2	PF00270.31	0.71	5	1086.0	opposite-strand	DEAD/DEAH box helicase
3	PF00271.33	0.86	6	1090	opposite-strand	Helicase conserved C-terminal domain
4	PF03880.17	0.86	6	1090	opposite-strand	DbpA RNA binding domain
5	PF04851.17	0.71	5	1086.0	opposite-strand	Type III restriction enzyme, res subunit
6	PF01171.22	0.86	6	52	same-strand	PP-loop family