Result : EXP00449
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00449 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 1700842 |
| Right | 1700916 |
| Strand | + |
| Nucleotide Sequence | TTGCTTATACGACCACTGCGCCTCCTGTTCTATACCCAAAATAATTCGAGTTGCGTAAAGGCGGCAAGGGAGTGA |
| Sequence | LLIRPLRLLFYTQNNSSCVKAARE |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 24 |
++ More..
| Conservation Analysis |
No. of Species: 10
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1690859 | 1690933 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 252955 | 253035 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 3 | 1611954 | 1612025 | - | NZ_CP020388.1 | Pluralibacter gergoviae |
| 4 | 2840319 | 2840399 | - | NZ_CP053416.1 | Salmonella bongori |
| 5 | 4459581 | 4459643 | + | NZ_CP011118.1 | Yersinia enterocolitica |
| 6 | 2937488 | 2937559 | - | NZ_CP015137.1 | Dickeya solani IPO 2222 |
| 7 | 2671976 | 2672053 | + | NZ_CP015137.1 | Dickeya solani IPO 2222 |
| 8 | 4569854 | 4569928 | + | NZ_CP007230.1 | Yersinia similis |
| 9 | 3255952 | 3256014 | - | NZ_CP015749.1 | Pectobacterium parmentieri |
| 10 | 4810468 | 4810542 | - | NZ_CP046293.1 | Yersinia intermedia |
| 11 | 3578034 | 3578102 | - | NZ_CP009787.1 | Yersinia rohdei |
| 12 | 2315998 | 2316066 | - | NZ_CP038498.1 | Pectobacterium punjabense |
++ More..