Result : EXP00447
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00447 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 1536352 |
| Right | 1536399 |
| Strand | + |
| Nucleotide Sequence | ATGGTAGTGCGGGGACGAGCAAAAAAAAAGCCGCTAACGCACAGTTAG |
| Sequence | MVVRGRAKKKPLTHS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1526367 | 1526414 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3915595 | 3915642 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 2698349 | 2698396 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
| 4 | 891964 | 892011 | + | NZ_CP023529.1 | Lelliottia amnigena |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF09864.11 | 1.0 | 4 | 3732.0 | same-strand | Membrane-bound lysozyme-inhibitor of c-type lysozyme |
| 2 | PF01243.22 | 1.0 | 4 | 3017.5 | same-strand | Pyridoxamine 5'-phosphate oxidase |
| 3 | PF10590.11 | 1.0 | 4 | 3017.5 | same-strand | Pyridoxine 5'-phosphate oxidase C-terminal dimerisation region |
| 4 | PF00579.27 | 1.0 | 4 | 1617.0 | same-strand | tRNA synthetases class I (W and Y) |
| 5 | PF01479.27 | 0.75 | 3 | 1615 | same-strand | S4 domain |
| 6 | PF00043.27 | 1.0 | 4 | 31.0 | opposite-strand | Glutathione S-transferase, C-terminal domain |
| 7 | PF13409.8 | 1.0 | 4 | 31.0 | opposite-strand | Glutathione S-transferase, N-terminal domain |
| 8 | PF02798.22 | 1.0 | 4 | 31.0 | opposite-strand | Glutathione S-transferase, N-terminal domain |
| 9 | PF13410.8 | 1.0 | 4 | 31.0 | opposite-strand | Glutathione S-transferase, C-terminal domain |
| 10 | PF14497.8 | 1.0 | 4 | 31.0 | opposite-strand | Glutathione S-transferase, C-terminal domain |
| 11 | PF00854.23 | 1.0 | 4 | 29.0 | opposite-strand | POT family |
| 12 | PF07690.18 | 1.0 | 4 | 29.0 | opposite-strand | Major Facilitator Superfamily |
| 13 | PF00730.27 | 1.0 | 4 | 2144.0 | opposite-strand | HhH-GPD superfamily base excision DNA repair protein |
| 14 | PF00633.25 | 1.0 | 4 | 2144.0 | opposite-strand | Helix-hairpin-helix motif |
| 15 | PF10576.11 | 1.0 | 4 | 2144.0 | opposite-strand | Iron-sulfur binding domain of endonuclease III |
| 16 | PF02508.16 | 1.0 | 4 | 2777.5 | opposite-strand | Rnf-Nqr subunit, membrane protein |
| 17 | PF04205.16 | 1.0 | 4 | 3469.5 | opposite-strand | FMN-binding domain |
| 18 | PF03116.17 | 1.0 | 4 | 4097.0 | opposite-strand | NQR2, RnfD, RnfE family |
++ More..