Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00446 |
NCBI Accession ID | NC_016856.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
Left | 1425535 |
Right | 1425597 |
Strand | + |
Nucleotide Sequence | GTGAAAAACGAAACGAAAAACAGCGCAAAAAAGCCTCCTGATGGAGGCTTTTTTTGTATCTGA |
Sequence | VKNETKNSAKKPPDGGFFCI |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 28122954 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 20 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1415550 | 1415612 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 3827396 | 3827458 | + | NZ_CP053416.1 | Salmonella bongori |
3 | 1926110 | 1926181 | + | NZ_CP027986.1 | Enterobacter sichuanensis |
4 | 1665709 | 1665771 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
5 | 2101321 | 2101392 | + | NZ_CP045845.1 | Kluyvera intermedia |
6 | 787938 | 788006 | + | NZ_CP023529.1 | Lelliottia amnigena |
7 | 2789985 | 2790056 | - | NZ_CP013990.1 | Leclercia adecarboxylata |
8 | 1959951 | 1960013 | + | NZ_CP054058.1 | Scandinavium goeteborgense |
9 | 1579161 | 1579217 | - | NZ_CP045769.1 | Enterobacter cancerogenus |
10 | 1131051 | 1131107 | + | NZ_CP017279.1 | Enterobacter ludwigii |
11 | 1887553 | 1887609 | + | NC_015968.1 | Enterobacter soli |
12 | 3622579 | 3622644 | - | NZ_CP023706.1 | Edwardsiella tarda |
13 | 2142480 | 2142536 | + | NZ_CP043318.1 | Enterobacter chengduensis |
14 | 1921221 | 1921277 | + | NZ_CP009756.1 | Enterobacter cloacae |
15 | 632999 | 633055 | - | NZ_CP025034.2 | Enterobacter sp. SGAir0187 |
16 | 1861330 | 1861386 | + | NZ_CP017184.1 | Enterobacter roggenkampii |
17 | 1892856 | 1892912 | + | NZ_AP022508.1 | Enterobacter bugandensis |
18 | 4389163 | 4389219 | + | NZ_AP019007.1 | Enterobacter oligotrophicus |
19 | 2769045 | 2769104 | + | NC_005966.1 | Acinetobacter baylyi ADP1 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF00587.27 | 0.95 | 18 | 1439.5 | same-strand | tRNA synthetase class II core domain (G, H, P, S and T) |
2 | PF03129.22 | 0.95 | 18 | 1439.5 | same-strand | Anticodon binding domain |
3 | PF07973.16 | 0.95 | 18 | 1439.5 | same-strand | Threonyl and Alanyl tRNA synthetase second additional domain |
4 | PF02824.23 | 0.95 | 18 | 1439.5 | same-strand | TGS domain |
5 | PF00707.24 | 0.95 | 18 | 893.5 | same-strand | Translation initiation factor IF-3, C-terminal domain |
6 | PF01632.21 | 0.95 | 18 | 598.5 | same-strand | Ribosomal protein L35 |
7 | PF00453.20 | 0.95 | 18 | 192.0 | same-strand | Ribosomal protein L20 |
8 | PF01409.22 | 0.95 | 18 | 57.0 | same-strand | tRNA synthetases class II core domain (F) |
9 | PF02912.20 | 0.95 | 18 | 57.0 | same-strand | Aminoacyl tRNA synthetase class II, N-terminal domain |
10 | PF03483.19 | 0.95 | 18 | 1056.0 | same-strand | B3/4 domain |
11 | PF17759.3 | 0.95 | 18 | 1056.0 | same-strand | Phenylalanyl tRNA synthetase beta chain CLM domain |
12 | PF03147.16 | 0.95 | 18 | 1056.0 | same-strand | Ferredoxin-fold anticodon binding domain |
13 | PF01588.22 | 0.95 | 18 | 1056.0 | same-strand | Putative tRNA binding domain |
14 | PF03484.17 | 0.95 | 18 | 1056.0 | same-strand | tRNA synthetase B5 domain |
15 | PF00216.23 | 0.95 | 18 | 3448.0 | same-strand | Bacterial DNA-binding protein |
16 | PF01032.20 | 0.95 | 18 | 3850.5 | same-strand | FecCD transport family |
17 | PF00255.21 | 0.68 | 13 | 4854 | same-strand | Glutathione peroxidase |