Result : EXP00437
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00437 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 994905 |
| Right | 994970 |
| Strand | + |
| Nucleotide Sequence | GTGATGTCGATAGCTGCCGCGAGGCAACGGTCTTCTCACCATAGACCAGGCATTGCGCGCCGTTAA |
| Sequence | VMSIAAARQRSSHHRPGIARR |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1036579 | 1036644 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 4567665 | 4567730 | + | NZ_CP057657.1 | Escherichia fergusonii |
| 3 | 2565273 | 2565338 | + | NC_020126.1 | Myxococcus stipitatus DSM 14675 |
| 4 | 1407778 | 1407840 | - | NZ_LR593887.1 | Tuwongella immobilis |
++ More..