Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00436 |
NCBI Accession ID | NC_016856.1 |
Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
Left | 980608 |
Right | 980673 |
Strand | + |
Nucleotide Sequence | GTGTGCATAGACTCTGGTCAGCGGCAGATTTTCCTGCCGACAACTGTAACCGATAATGACGACTGA |
Sequence | VCIDSGQRQIFLPTTVTDNDD |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 28122954 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 21 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 1022282 | 1022347 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
2 | 3457245 | 3457310 | + | NZ_CP053416.1 | Salmonella bongori |
3 | 2039570 | 2039641 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
4 | 371977 | 372042 | + | NZ_CP038469.1 | Citrobacter tructae |
5 | 3915179 | 3915244 | - | NZ_CP045205.1 | Citrobacter telavivensis |
6 | 3183605 | 3183670 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF11398.10 | 1.0 | 6 | 4717.5 | same-strand | Protein of unknown function (DUF2813) |
2 | PF04393.15 | 0.83 | 5 | 3784 | opposite-strand | Protein of unknown function (DUF535) |
3 | PF16576.7 | 1.0 | 6 | 2528.5 | same-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
4 | PF13437.8 | 1.0 | 6 | 2528.5 | same-strand | HlyD family secretion protein |
5 | PF13533.8 | 1.0 | 6 | 2528.5 | same-strand | Biotin-lipoyl like |
6 | PF12704.9 | 1.0 | 6 | 585.5 | same-strand | MacB-like periplasmic core domain |
7 | PF00005.29 | 1.0 | 6 | 585.5 | same-strand | ABC transporter |
8 | PF02687.23 | 1.0 | 6 | 585.5 | same-strand | FtsX-like permease family |
9 | PF00313.24 | 1.0 | 6 | 256.0 | opposite-strand | 'Cold-shock' DNA-binding domain |
10 | PF02617.19 | 1.0 | 6 | 3.0 | same-strand | ATP-dependent Clp protease adaptor protein ClpS |
11 | PF07724.16 | 1.0 | 6 | 354.0 | same-strand | AAA domain (Cdc48 subfamily) |
12 | PF17871.3 | 1.0 | 6 | 354.0 | same-strand | AAA lid domain |
13 | PF10431.11 | 1.0 | 6 | 354.0 | same-strand | C-terminal, D2-small domain, of ClpB protein |
14 | PF00004.31 | 1.0 | 6 | 354.0 | same-strand | ATPase family associated with various cellular activities (AAA) |
15 | PF07728.16 | 1.0 | 6 | 354.0 | same-strand | AAA domain (dynein-related subfamily) |
16 | PF02861.22 | 1.0 | 6 | 354.0 | same-strand | Clp amino terminal domain, pathogenicity island component |
17 | PF05621.13 | 1.0 | 6 | 354.0 | same-strand | Bacterial TniB protein |