Result : EXP00435
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00435 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 980503 |
| Right | 980580 |
| Strand | + |
| Nucleotide Sequence | ATGAATCAAAAATTTGAAGCAGTTAACGCTATTGCCGGGAATGTGACAGATGTCGCGGATGGTACTGATAGATGTTAG |
| Sequence | MNQKFEAVNAIAGNVTDVADGTDRC |
| Source of smORF | Ribo-seq |
| Function | INDUCTION: Expressed equally in exponential and stationary phase in rich medium (at protein level) Pubmed:30837344 |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Gene Ontology/Expression based functional assignment |
| Uniprot ID | P0DSE8 |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 14
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1022177 | 1022254 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3457140 | 3457214 | + | NZ_CP053416.1 | Salmonella bongori |
| 3 | 3915275 | 3915349 | - | NZ_CP045205.1 | Citrobacter telavivensis |
| 4 | 3183500 | 3183574 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
| 5 | 978918 | 978992 | + | NC_013716.1 | Citrobacter rodentium ICC168 |
| 6 | 947941 | 948015 | + | NZ_AP014857.1 | Escherichia albertii |
| 7 | 1053816 | 1053890 | + | NC_002695.2 | Escherichia coli O157:H7 str. Sakai |
| 8 | 922740 | 922814 | + | NC_000913.3 | Escherichia coli str. K-12 substr. MG1655 |
| 9 | 874053 | 874127 | + | NC_004337.2 | Shigella flexneri 2a str. 301 |
| 10 | 1419544 | 1419618 | + | NZ_CP061527.1 | Shigella dysenteriae |
| 11 | 1571713 | 1571787 | + | NZ_LR134340.1 | Escherichia marmotae |
| 12 | 2971616 | 2971696 | - | NZ_AP023184.1 | Buttiauxella agrestis |
| 13 | 3333459 | 3333548 | + | NZ_CP042941.1 | Atlantibacter hermannii |
| 14 | 1650673 | 1650753 | + | NZ_CP012871.1 | [Enterobacter] lignolyticus |
| 15 | 4072480 | 4072554 | - | NZ_CP060111.1 | Klebsiella michiganensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_LT556085.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF11398.10 | 1.0 | 14 | 4609 | same-strand | Protein of unknown function (DUF2813) |
| 2 | PF04393.15 | 0.93 | 13 | 3647.5 | opposite-strand | Protein of unknown function (DUF535) |
| 3 | PF16576.7 | 1.0 | 14 | 2390 | same-strand | Barrel-sandwich domain of CusB or HlyD membrane-fusion |
| 4 | PF13437.8 | 1.0 | 14 | 2390.5 | same-strand | HlyD family secretion protein |
| 5 | PF13533.8 | 1.0 | 14 | 2390 | same-strand | Biotin-lipoyl like |
| 6 | PF12704.9 | 1.0 | 14 | 447 | same-strand | MacB-like periplasmic core domain |
| 7 | PF00005.29 | 1.0 | 14 | 479.5 | same-strand | ABC transporter |
| 8 | PF02687.23 | 1.0 | 14 | 447 | same-strand | FtsX-like permease family |
| 9 | PF00313.24 | 1.0 | 14 | 150 | opposite-strand | 'Cold-shock' DNA-binding domain |
| 10 | PF02617.19 | 1.0 | 14 | 99 | same-strand | ATP-dependent Clp protease adaptor protein ClpS |
| 11 | PF07724.16 | 1.0 | 14 | 450 | same-strand | AAA domain (Cdc48 subfamily) |
| 12 | PF17871.3 | 1.0 | 14 | 450 | same-strand | AAA lid domain |
| 13 | PF10431.11 | 1.0 | 14 | 450 | same-strand | C-terminal, D2-small domain, of ClpB protein |
| 14 | PF00004.31 | 1.0 | 14 | 450 | same-strand | ATPase family associated with various cellular activities (AAA) |
| 15 | PF07728.16 | 1.0 | 14 | 450 | same-strand | AAA domain (dynein-related subfamily) |
| 16 | PF02861.22 | 1.0 | 14 | 450 | same-strand | Clp amino terminal domain, pathogenicity island component |
| 17 | PF05621.13 | 1.0 | 14 | 450 | same-strand | Bacterial TniB protein |
| 18 | PF01176.21 | 0.64 | 9 | 3412.0 | opposite-strand | Translation initiation factor 1A / IF-1 |
++ More..