Result : EXP00433

Protein Information

• Protein name: EXP00433
• NCBI Accession ID: NC_016856.1
• Organism: Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S
• Left: 900486
• Right: 900533
• Strand: +
• Nucleotide Sequence: ATGAAAGGCGCCCTTAGACACCGTGAATCGCAAAGAGTTTCCCATTAA
• Sequence: MKGALRHRESQRVSH
• Source of smORF: Ribo-seq
• Pubmed ID: 28122954
• Functional Category: Function not yet assigned
• ORF Length (Amino Acid): 15

Conservation Analysis

No. of Species: 2

Sr.No.	Left Position	Right Position	Strand	NCBI Accession id	Species Name
1	899437	899484	+	NC_003197.2	Salmonella enterica subsp. enterica serovar Typhimurium str. LT2
2	3378466	3378513	+	NZ_CP053416.1	Salmonella bongori

Neighborhood Conservation Analysis

^* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
^* 'Small ORF' represents the entry/query analyzed.
^* Image generated using 'gggenes'(R-Package).

Neighborhood Representative Chosen(Species): NC_003197.2

Sr.No.	Domain	Co-occurrence Frequency	No. of species in which domain occurs with smORF	Median distance b/w smORF and domain bearing ORFs	Orientation relative to smORF	PFAM Information
1	PF00005.29	1.0	2	3977.0	opposite-strand	ABC transporter
2	PF00528.24	1.0	2	3321.0	opposite-strand	Binding-protein-dependent transport system inner membrane component
3	PF00497.22	1.0	2	2414.5	opposite-strand	Bacterial extracellular solute-binding proteins, family 3
4	PF00210.26	1.0	2	1437.5	opposite-strand	Ferritin-like domain
5	PF00892.22	1.0	2	254.0	opposite-strand	EamA-like transporter family
6	PF13505.8	1.0	2	53.0	same-strand	Outer membrane protein beta-barrel domain
7	PF06316.13	1.0	2	53.0	same-strand	Enterobacterial Ail/Lom protein
8	PF00884.25	1.0	2	630.5	opposite-strand	Sulfatase
9	PF02742.17	1.0	2	2789.0	same-strand	Iron dependent repressor, metal binding and dimerisation domain
10	PF01325.21	1.0	2	2789.0	same-strand	Iron dependent repressor, N-terminal DNA binding domain
11	PF03600.18	1.0	2	3259.0	same-strand	Citrate transporter