Result : EXP00432
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00432 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 900390 |
| Right | 900452 |
| Strand | + |
| Nucleotide Sequence | ATGAATGTATCGCGCCGCACGCGCATTATTGGTGCAATAAGCCGGAAAAGTGATGTTAATTGA |
| Sequence | MNVSRRTRIIGAISRKSDVN |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 20 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 899341 | 899403 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 3378370 | 3378432 | + | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00005.29 | 1.0 | 2 | 3881.0 | opposite-strand | ABC transporter |
| 2 | PF00528.24 | 1.0 | 2 | 3225.0 | opposite-strand | Binding-protein-dependent transport system inner membrane component |
| 3 | PF00497.22 | 1.0 | 2 | 2318.5 | opposite-strand | Bacterial extracellular solute-binding proteins, family 3 |
| 4 | PF00210.26 | 1.0 | 2 | 1341.5 | opposite-strand | Ferritin-like domain |
| 5 | PF00892.22 | 1.0 | 2 | 158.0 | opposite-strand | EamA-like transporter family |
| 6 | PF13505.8 | 1.0 | 2 | 134.0 | same-strand | Outer membrane protein beta-barrel domain |
| 7 | PF06316.13 | 1.0 | 2 | 134.0 | same-strand | Enterobacterial Ail/Lom protein |
| 8 | PF00884.25 | 1.0 | 2 | 711.5 | opposite-strand | Sulfatase |
| 9 | PF02742.17 | 1.0 | 2 | 2870.0 | same-strand | Iron dependent repressor, metal binding and dimerisation domain |
| 10 | PF01325.21 | 1.0 | 2 | 2870.0 | same-strand | Iron dependent repressor, N-terminal DNA binding domain |
| 11 | PF03600.18 | 1.0 | 2 | 3340.0 | same-strand | Citrate transporter |
++ More..