Result : EXP00431
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00431 |
| NCBI Accession ID | NC_016856.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. 14028S |
| Left | 801817 |
| Right | 801912 |
| Strand | + |
| Nucleotide Sequence | GTGCAGGAAACCTCTAAAAACTGCCATATGATTAGTAATAATCGAGATGTTCAGAGCGAGACAAGGCGCGGTCTGAACGAATCTTCGGGAGCATAG |
| Sequence | VQETSKNCHMISNNRDVQSETRRGLNESSGA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 28122954 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 31 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 801323 | 801418 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2953795 | 2953890 | + | NZ_LT556085.1 | Citrobacter amalonaticus |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01127.24 | 1.0 | 2 | 2779.5 | same-strand | Succinate dehydrogenase/Fumarate reductase transmembrane subunit |
| 2 | PF00890.26 | 1.0 | 2 | 843.0 | same-strand | FAD binding domain |
| 3 | PF02910.22 | 1.0 | 2 | 843.0 | same-strand | Fumarate reductase flavoprotein C-term |
| 4 | PF13085.8 | 1.0 | 2 | 110.5 | same-strand | 2Fe-2S iron-sulfur cluster binding domain |
| 5 | PF13534.8 | 1.0 | 2 | 110.5 | same-strand | 4Fe-4S dicluster domain |
| 6 | PF13183.8 | 1.0 | 2 | 110.5 | same-strand | 4Fe-4S dicluster domain |
| 7 | PF13237.8 | 1.0 | 2 | 110.5 | same-strand | 4Fe-4S dicluster domain |
| 8 | PF02779.26 | 1.0 | 2 | 264.0 | same-strand | Transketolase, pyrimidine binding domain |
| 9 | PF16870.7 | 1.0 | 2 | 264.0 | same-strand | 2-oxoglutarate dehydrogenase C-terminal |
| 10 | PF00676.22 | 1.0 | 2 | 264.0 | same-strand | Dehydrogenase E1 component |
| 11 | PF16078.7 | 1.0 | 2 | 264.0 | same-strand | 2-oxoglutarate dehydrogenase N-terminus |
| 12 | PF00198.25 | 1.0 | 2 | 3080.0 | same-strand | 2-oxoacid dehydrogenases acyltransferase (catalytic domain) |
| 13 | PF00364.24 | 1.0 | 2 | 3080.0 | same-strand | Biotin-requiring enzyme |
| 14 | PF02817.19 | 1.0 | 2 | 3080.0 | same-strand | e3 binding domain |
| 15 | PF08442.12 | 1.0 | 2 | 4423.0 | same-strand | ATP-grasp domain |
| 16 | PF00549.21 | 1.0 | 2 | 5006.0 | same-strand | CoA-ligase |
| 17 | PF13549.8 | 1.0 | 2 | 4423.0 | same-strand | ATP-grasp domain |
| 18 | PF02629.21 | 1.0 | 2 | 5589.0 | same-strand | CoA binding domain |
| 19 | PF13607.8 | 1.0 | 2 | 5589.0 | same-strand | Succinyl-CoA ligase like flavodoxin domain |
++ More..