Result : B1IIA6
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | Protein Tlp homolog |
| NCBI Accession ID | CP000939.1 |
| Organism | Clostridium botulinum (strain Okra / Type B1) |
| Left | 1147936 |
| Right | 1148163 |
| Strand | + |
| Nucleotide Sequence | ATGAAAAATAAACCAGATGATAGAAGAGATAATGTAGATAAAATTCAATATAATATTACTAAGACTATTCAAAATTGTGAGTTTGCAGATGAAATTATTGCAAAAACAGATGATGAAAAAACGAAAAAAACTCTAATAGAAAAAAATGAAAGAAGAAGAGAAGCTCTTGATGGTATGAGAGAAGAAATTAAAGATGAAGCAAGAGATAAGAAAAATGGATATATGTAA |
| Sequence | MKNKPDDRRDNVDKIQYNITKTIQNCEFADEIIAKTDDEKTKKTLIEKNERRREALDGMREEIKDEARDKKNGYM |
| Source of smORF | Swiss-Prot |
| Function | The ORF matches to the profile of cl07951. Profile Description: N/A. This protein family is restricted to a subset of endospore-forming bacteria such as Bacillus subtilis, all of which are in the Firmicutes (low-GC Gram-positive) lineage. Although previously designated tlp (thioredoxin-like protein), the B. subtilis protein was shown to be a minor small acid-soluble spore protein SASP, unique to spores. The motif E[VIL]XDE near the C-terminus probably represents at a germination protease cleavage site. [Cellular processes, Sporulation and germination] |
| Pubmed ID | 18060065 |
| Domain | CDD:186720 |
| Functional Category | Others |
| Uniprot ID | B1IIA6 |
| ORF Length (Amino Acid) | 75 |
++ More..
| Conservation Analysis |
No. of Species: 30
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1143989 | 1144216 | + | NZ_CP028842.1 | Clostridium botulinum |
| 2 | 1129423 | 1129650 | + | NZ_CP011663.1 | Clostridium sporogenes |
| 3 | 5052125 | 5052352 | - | NC_014393.1 | Clostridium cellulovorans 743B |
| 4 | 5914396 | 5914623 | - | NC_020291.1 | Clostridium saccharoperbutylacetonicum N1-4(HMT) |
| 5 | 769117 | 769344 | + | NZ_CP014176.1 | Clostridium argentinense |
| 6 | 536422 | 536649 | - | NZ_CP046996.1 | Dehalobacter restrictus |
| 7 | 5252287 | 5252514 | - | NZ_CP043998.1 | Clostridium diolis |
| 8 | 3972317 | 3972544 | - | NZ_CP071376.1 | Clostridium gasigenes |
| 9 | 3851464 | 3851694 | - | NZ_CP021850.1 | Pseudoclostridium thermosuccinogenes |
| 10 | 2596488 | 2596715 | - | NZ_CP017253.2 | Clostridium taeniosporum |
| 11 | 900760 | 900987 | + | NZ_CP015756.1 | Clostridium estertheticum subsp. estertheticum |
| 12 | 1012428 | 1012649 | + | NZ_CP061336.1 | Ruminiclostridium herbifermentans |
| 13 | 1519915 | 1520142 | - | NC_015589.1 | Desulfotomaculum ruminis DSM 2154 |
| 14 | 3022362 | 3022556 | - | NC_011898.1 | Ruminiclostridium cellulolyticum H10 |
| 15 | 1143464 | 1143697 | + | NZ_CP014204.2 | Clostridium baratii |
| 16 | 1528029 | 1528256 | - | NZ_CP016786.1 | Clostridium isatidis |
| 17 | 398034 | 398258 | - | NZ_CP040924.1 | Clostridium thermarum |
| 18 | 1636469 | 1636696 | + | NC_015687.1 | Clostridium acetobutylicum DSM 1731 |
| 19 | 511936 | 512163 | - | NC_011837.1 | Clostridium kluyveri NBRC 12016 |
| 20 | 375094 | 375282 | + | NZ_CP009709.1 | Weizmannia coagulans DSM 1 = ATCC 7050 |
| 21 | 1491924 | 1492121 | - | NZ_CP022121.1 | Dehalobacterium formicoaceticum |
| 22 | 1687673 | 1687903 | - | NZ_CP012024.1 | Bacillus smithii |
| 23 | 1779135 | 1779365 | + | NZ_CP015438.1 | Anoxybacillus amylolyticus |
| 24 | 1444835 | 1445059 | - | NZ_CP012152.1 | Anoxybacillus gonensis |
| 25 | 2727489 | 2727716 | + | NZ_AP021853.1 | Sporolactobacillus terrae |
| 26 | 1962134 | 1962316 | + | NZ_CP070511.1 | Parageobacillus toebii |
| 27 | 2022587 | 2022796 | - | NZ_AP017312.1 | Aneurinibacillus soli |
| 28 | 198671 | 198895 | + | NC_004193.1 | Oceanobacillus iheyensis HTE831 |
| 29 | 1940534 | 1940749 | + | NZ_CP024848.1 | Oceanobacillus zhaokaii |
| 30 | 847830 | 848054 | + | NZ_CP013862.1 | Lentibacillus amyloliquefaciens |
++ More..