Result : EXP00424
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00424 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 4794038 |
| Right | 4794073 |
| Strand | - |
| Nucleotide Sequence | GTGCTGATTGTTATCTGTAATCGCCACACGTTCTGA |
| Sequence | VLIVICNRHTF |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 11 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 4773473 | 4773508 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 2526382 | 2526417 | - | NZ_CP053416.1 | Salmonella bongori |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06779.16 | 1.0 | 2 | 3020.0 | same-strand | Uncharacterised MFS-type transporter YbfB |
| 2 | PF07690.18 | 1.0 | 2 | 1582.0 | same-strand | Major Facilitator Superfamily |
| 3 | PF04286.14 | 1.0 | 2 | 1529.5 | same-strand | Protein of unknown function (DUF445) |
| 4 | PF00171.24 | 1.0 | 2 | 1187.5 | opposite-strand | Aldehyde dehydrogenase family |
| 5 | PF06568.13 | 1.0 | 2 | 2760.0 | opposite-strand | Domain of unknown function (DUF1127) |
| 6 | PF08845.12 | 1.0 | 2 | 3922.0 | same-strand | Toxin SymE, type I toxin-antitoxin system |
++ More..