Result : EXP00419
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00419 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 3781737 |
| Right | 3781814 |
| Strand | - |
| Nucleotide Sequence | GTGGGCGGGTCGCCGGGGAGGAGATATGATAAGCACCGTCTCACTATTCTGGGCTTTATGTGTCGTTTGCATTGTTAA |
| Sequence | VGGSPGRRYDKHRLTILGFMCRLHC |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 7
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1602218 | 1602295 | - | NZ_CP053416.1 | Salmonella bongori |
| 2 | 3760427 | 3760504 | - | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 3 | 4532050 | 4532127 | - | NC_009792.1 | Citrobacter koseri ATCC BAA-895 |
| 4 | 2649328 | 2649405 | + | NZ_CP044098.1 | Citrobacter portucalensis |
| 5 | 2409162 | 2409239 | - | NZ_CP033744.1 | Citrobacter freundii |
| 6 | 4127028 | 4127105 | - | NZ_LR134340.1 | Escherichia marmotae |
| 7 | 3662110 | 3662187 | + | NZ_CP038469.1 | Citrobacter tructae |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP053416.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF13437.8 | 0.86 | 6 | 4354.5 | same-strand | HlyD family secretion protein |
| 2 | PF13533.8 | 0.86 | 6 | 4354.5 | same-strand | Biotin-lipoyl like |
| 3 | PF00529.22 | 0.86 | 6 | 4354.5 | same-strand | Cation efflux system protein CusB domain 1 |
| 4 | PF03486.16 | 1.0 | 7 | 2081 | same-strand | HI0933-like protein |
| 5 | PF01384.22 | 1.0 | 7 | 351 | opposite-strand | Phosphate transporter family |
| 6 | PF10625.11 | 1.0 | 7 | -52 | same-strand | Universal stress protein B (UspB) |
| 7 | PF00582.28 | 1.0 | 7 | 368 | opposite-strand | Universal stress protein family |
| 8 | PF00854.23 | 1.0 | 7 | 1098 | opposite-strand | POT family |
| 9 | PF07690.18 | 0.86 | 6 | 1099.0 | opposite-strand | Major Facilitator Superfamily |
| 10 | PF02082.22 | 0.71 | 5 | 2647 | same-strand | Iron-dependent Transcriptional regulator |
| 11 | PF04445.15 | 0.86 | 6 | 4632.5 | same-strand | Putative SAM-dependent methyltransferase |
++ More..