Result : EXP00404
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00404 |
| NCBI Accession ID | NC_016810.1 |
| Organism | Salmonella enterica subsp. enterica serovar Typhimurium str. SL1344 |
| Left | 1294617 |
| Right | 1294694 |
| Strand | + |
| Nucleotide Sequence | ATGACCGGATCCGGGTATTTGTGTTTAAGATATAACCGTAAAAACATCAGCGCCCAGACCAGAACGCCCATATCATAG |
| Sequence | MTGSGYLCLRYNRKNISAQTRTPIS |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | Venturini et al 2020 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 25 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1337754 | 1337831 | + | NC_003197.2 | Salmonella enterica subsp. enterica serovar Typhimurium str. LT2 |
| 2 | 1828719 | 1828784 | + | NZ_CP050150.1 | Hafnia alvei |
| 3 | 3582360 | 3582434 | - | NZ_CP013940.1 | Cronobacter malonaticus LMG 23826 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_003197.2
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01292.22 | 0.67 | 2 | -71.0 | opposite-strand | Prokaryotic cytochrome b561 |
++ More..