Result : EXP00390
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00390 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 2773140 |
| Right | 2773205 |
| Strand | - |
| Nucleotide Sequence | ATGGTGGTTGTTCTGTTAACACGATCGTCGAGGCATCCCCGGCGATTGGGTGTCGCCGAGGTCTAA |
| Sequence | MVVVLLTRSSRHPRRLGVAEV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2773140 | 2773205 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 1235106 | 1235171 | + | NZ_CP027850.1 | Caulobacter segnis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01145.27 | 1.0 | 2 | 4676.0 | opposite-strand | SPFH domain / Band 7 family |
| 2 | PF02517.18 | 1.0 | 2 | 3387.5 | opposite-strand | Type II CAAX prenyl endopeptidase Rce1-like |
| 3 | PF00091.27 | 1.0 | 2 | 35.0 | same-strand | Tubulin/FtsZ family, GTPase domain |
| 4 | PF12327.10 | 1.0 | 2 | 35.0 | same-strand | FtsZ family, C-terminal domain |
| 5 | PF14450.8 | 1.0 | 2 | 273.5 | same-strand | Cell division protein FtsA |
| 6 | PF02491.22 | 1.0 | 2 | 273.5 | same-strand | SHS2 domain inserted in FTSA |
| 7 | PF08478.12 | 1.0 | 2 | 1629.5 | same-strand | POTRA domain, FtsQ-type |
| 8 | PF03799.17 | 1.0 | 2 | 1629.5 | same-strand | Cell division protein FtsQ |
| 9 | PF07478.15 | 1.0 | 2 | 2506.5 | same-strand | D-ala D-ala ligase C-terminus |
| 10 | PF02655.16 | 1.0 | 2 | 2506.5 | same-strand | ATP-grasp domain |
| 11 | PF04389.19 | 1.0 | 2 | 3670.0 | same-strand | Peptidase family M28 |
| 12 | PF02873.18 | 1.0 | 2 | 5521.0 | same-strand | UDP-N-acetylenolpyruvoylglucosamine reductase, C-terminal domain |
| 13 | PF01565.25 | 1.0 | 2 | 5521.0 | same-strand | FAD binding domain |
++ More..