Result : EXP00388
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00388 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 2394598 |
| Right | 2394657 |
| Strand | - |
| Nucleotide Sequence | ATGATCAATCGTGAACGCTTCTGGCGCCGCCGCTCGTCGGGCCAAACCTGCTCGGTATGA |
| Sequence | MINRERFWRRRSSGQTCSV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 19 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 2394598 | 2394657 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 3074595 | 3074654 | - | NZ_CP027850.1 | Caulobacter segnis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF14588.8 | 1.0 | 2 | 3595.5 | same-strand | YjgF/chorismate mutase-like, putative endoribonuclease |
| 2 | PF01042.23 | 1.0 | 2 | 3595.5 | same-strand | Endoribonuclease L-PSP |
| 3 | PF09361.12 | 1.0 | 2 | 3007.5 | same-strand | Phasin protein |
| 4 | PF00768.22 | 1.0 | 2 | 1399.5 | opposite-strand | D-alanyl-D-alanine carboxypeptidase |
| 5 | PF05036.15 | 1.0 | 2 | 1399.5 | opposite-strand | SPOR domain |
| 6 | PF00155.23 | 1.0 | 2 | 80.5 | same-strand | Aminotransferase class I and II |
| 7 | PF09140.13 | 1.0 | 2 | 522.0 | same-strand | ATPase MipZ |
| 8 | PF02569.17 | 1.0 | 2 | 1557.5 | opposite-strand | Pantoate-beta-alanine ligase |
| 9 | PF07370.13 | 1.0 | 2 | 2588.0 | same-strand | Protein of unknown function (DUF1489) |
++ More..