Result : EXP00383
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00383 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 1571872 |
| Right | 1571955 |
| Strand | - |
| Nucleotide Sequence | ATGACCCTCGCCGCCTGCCAACAGCAGTTTTGGTATTTTAGCTATCCGACGCCTCTGGCGCCGGGAGGGTGTCGTTTGGCCTGA |
| Sequence | MTLAACQQQFWYFSYPTPLAPGGCRLA |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 27 |
++ More..
| Conservation Analysis |
No. of Species: 5
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 1571872 | 1571955 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 5121470 | 5121553 | + | NZ_CP026100.1 | Caulobacter flavus |
| 3 | 600443 | 600526 | + | NZ_CP027850.1 | Caulobacter segnis |
| 4 | 1839432 | 1839515 | - | NZ_CP048815.1 | Caulobacter rhizosphaerae |
| 5 | 3256220 | 3256303 | + | NZ_CP041690.1 | Youhaiella tibetensis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NZ_CP026100.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF00793.22 | 1.0 | 5 | 97 | same-strand | DAHP synthetase I family |
| 2 | PF07715.17 | 0.6 | 3 | 3384.5 | same-strand | TonB-dependent Receptor Plug Domain |
++ More..