Result : EXP00372
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00372 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 659960 |
| Right | 660031 |
| Strand | - |
| Nucleotide Sequence | ATGCGCACCCCGCATCAGGTTCTCGTGCGCCGGTCTGTTCAGTACCATCTGAAAGACTGGTTCAACGAGTGA |
| Sequence | MRTPHQVLVRRSVQYHLKDWFNE |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 23 |
++ More..
| Conservation Analysis |
No. of Species: 2
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 659960 | 660031 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 2701837 | 2701908 | - | NZ_CP013002.1 | Caulobacter henricii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF01112.20 | 1.0 | 2 | 5801.0 | same-strand | Asparaginase |
| 2 | PF03606.17 | 1.0 | 2 | 3075.0 | same-strand | C4-dicarboxylate anaerobic carrier |
| 3 | PF00593.26 | 1.0 | 2 | 202 | same-strand | TonB dependent receptor |
| 4 | PF07715.17 | 1.0 | 2 | 202 | same-strand | TonB-dependent Receptor Plug Domain |
++ More..