Result : EXP00371
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00371 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 560907 |
| Right | 560972 |
| Strand | - |
| Nucleotide Sequence | ATGTCCATCGCCGTCCGCATCTTCGACATCGTCGTCGTCGCCCTGATCTTCACGGCCCTGACCTGA |
| Sequence | MSIAVRIFDIVVVALIFTALT |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 21 |
++ More..
| Conservation Analysis |
No. of Species: 4
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 560907 | 560972 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 398379 | 398447 | - | NZ_CP027850.1 | Caulobacter segnis |
| 3 | 490510 | 490578 | - | NZ_CP013002.1 | Caulobacter henricii |
| 4 | 3321379 | 3321444 | + | NC_014375.1 | Brevundimonas subvibrioides ATCC 15264 |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07879.13 | 1.0 | 4 | 602.0 | same-strand | PHB/PHA accumulation regulator DNA-binding domain |
| 2 | PF05233.15 | 1.0 | 4 | 602.0 | same-strand | PHB accumulation regulatory domain |
| 3 | PF00108.25 | 1.0 | 4 | 1607 | opposite-strand | Thiolase, N-terminal domain |
| 4 | PF02803.20 | 1.0 | 4 | 1607 | opposite-strand | Thiolase, C-terminal domain |
| 5 | PF13561.8 | 0.75 | 3 | 2853 | opposite-strand | Enoyl-(Acyl carrier protein) reductase |
| 6 | PF00106.27 | 0.75 | 3 | 2853 | opposite-strand | short chain dehydrogenase |
| 7 | PF08659.12 | 0.75 | 3 | 2853 | opposite-strand | KR domain |
| 8 | PF01370.23 | 0.75 | 3 | 2853 | opposite-strand | NAD dependent epimerase/dehydratase family |
++ More..