Result : EXP00370
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00370 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 461800 |
| Right | 461868 |
| Strand | - |
| Nucleotide Sequence | GTGACGGAATTTTCTCGAATGACAAGACCAAAAAGAAACCAATTGCAGACCGAGTCGTTATTGGTATGA |
| Sequence | VTEFSRMTRPKRNQLQTESLLV |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 22 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 461800 | 461868 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 452669 | 452737 | - | NZ_CP013002.1 | Caulobacter henricii |
| 3 | 4103722 | 4103790 | + | NZ_CP027850.1 | Caulobacter segnis |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF07715.17 | 1.0 | 3 | 1068.5 | opposite-strand | TonB-dependent Receptor Plug Domain |
| 2 | PF01979.22 | 1.0 | 3 | 1901 | same-strand | Amidohydrolase family |
| 3 | PF01380.24 | 0.67 | 2 | 846.0 | same-strand | SIS domain |
| 4 | PF07702.15 | 1.0 | 3 | 68 | same-strand | UTRA domain |
| 5 | PF00392.23 | 1.0 | 3 | 68 | same-strand | Bacterial regulatory proteins, gntR family |
| 6 | PF00593.26 | 1.0 | 3 | 124 | opposite-strand | TonB dependent receptor |
| 7 | PF00728.24 | 1.0 | 3 | 2957 | opposite-strand | Glycosyl hydrolase family 20, catalytic domain |
| 8 | PF02838.17 | 1.0 | 3 | 2957 | opposite-strand | Glycosyl hydrolase family 20, domain 2 |
| 9 | PF02896.20 | 1.0 | 3 | 5244 | opposite-strand | PEP-utilising enzyme, PEP-binding domain |
| 10 | PF00358.22 | 1.0 | 3 | 5244 | opposite-strand | phosphoenolpyruvate-dependent sugar phosphotransferase system, EIIA 1 |
| 11 | PF00381.21 | 1.0 | 3 | 5244 | opposite-strand | PTS HPr component phosphorylation site |
| 12 | PF05524.15 | 1.0 | 3 | 5244 | opposite-strand | PEP-utilising enzyme, N-terminal |
| 13 | PF00391.25 | 1.0 | 3 | 5244 | opposite-strand | PEP-utilising enzyme, mobile domain |
| 14 | PF02378.20 | 1.0 | 3 | 7793 | opposite-strand | Phosphotransferase system, EIIC |
| 15 | PF00367.22 | 1.0 | 3 | 7793 | opposite-strand | phosphotransferase system, EIIB |
++ More..