Protein Information |
Information Type | Description |
---|---|
Protein name | EXP00369 |
NCBI Accession ID | NC_011916.1 |
Organism | Caulobacter vibrioides NA1000 |
Left | 433090 |
Right | 433170 |
Strand | - |
Nucleotide Sequence | ATGATCGCGATCGGTATCATCGCCCTCTTCCTGGCCGTCATCATGGGCCTGAACCTGACCGAGTTCGGCCGCATCGACTAA |
Sequence | MIAIGIIALFLAVIMGLNLTEFGRID |
Source of smORF | Ribo-seq |
Function | |
Pubmed ID | 25078267 |
Domain | |
Functional Category | Function not yet assigned |
Uniprot ID | |
ORF Length (Amino Acid) | 26 |
Conservation Analysis |
Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
---|---|---|---|---|---|
1 | 433090 | 433170 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
2 | 555531 | 555611 | - | NZ_CP048815.1 | Caulobacter rhizosphaerae |
3 | 616350 | 616430 | - | NZ_CP027850.1 | Caulobacter segnis |
4 | 544927 | 545007 | - | NZ_CP026100.1 | Caulobacter flavus |
5 | 399329 | 399409 | - | NZ_CP013002.1 | Caulobacter henricii |
6 | 2438989 | 2439069 | + | NZ_CP022048.2 | Brevundimonas vesicularis |
7 | 379075 | 379155 | + | NZ_LR588407.1 | Brevundimonas vancanneytii |
8 | 914820 | 914900 | + | NC_014375.1 | Brevundimonas subvibrioides ATCC 15264 |
9 | 1735015 | 1735095 | + | NC_014816.1 | Asticcacaulis excentricus CB 48 |
10 | 3264298 | 3264378 | + | NC_011144.1 | Phenylobacterium zucineum HLK1 |
Neighborhood Conservation Analysis |
Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
---|---|---|---|---|---|---|
1 | PF02152.20 | 0.8 | 8 | 771.0 | same-strand | Dihydroneopterin aldolase |
2 | PF13561.8 | 1.0 | 10 | 7.0 | same-strand | Enoyl-(Acyl carrier protein) reductase |
3 | PF00106.27 | 1.0 | 10 | 7.0 | same-strand | short chain dehydrogenase |
4 | PF00293.30 | 0.8 | 8 | 379.0 | opposite-strand | NUDIX domain |