Result : EXP00366
| Protein Information |
| Information Type | Description |
|---|---|
| Protein name | EXP00366 |
| NCBI Accession ID | NC_011916.1 |
| Organism | Caulobacter vibrioides NA1000 |
| Left | 64440 |
| Right | 64487 |
| Strand | - |
| Nucleotide Sequence | ATGGCCGTGATCGGATTGTACGCGCCGCGATGGCGCGGCTCACACTGA |
| Sequence | MAVIGLYAPRWRGSH |
| Source of smORF | Ribo-seq |
| Function | |
| Pubmed ID | 25078267 |
| Domain | |
| Functional Category | Function not yet assigned |
| Uniprot ID | |
| ORF Length (Amino Acid) | 15 |
++ More..
| Conservation Analysis |
No. of Species: 3
| Sr.No. | Left Position | Right Position | Strand | NCBI Accession id | Species Name |
|---|---|---|---|---|---|
| 1 | 64440 | 64487 | - | NC_011916.1 | Caulobacter vibrioides NA1000 |
| 2 | 16630 | 16677 | + | NZ_CP027850.1 | Caulobacter segnis |
| 3 | 21939 | 21986 | + | NZ_CP013002.1 | Caulobacter henricii |
++ More..
| Neighborhood Conservation Analysis |
* Arrows marked in Genome Diagram shows ORFs; Multiple PFAMs can be mapped to a single ORF.
* 'Small ORF' represents the entry/query analyzed.
* Image generated using 'gggenes'(R-Package).
Neighborhood Representative Chosen(Species): NC_011916.1
| Sr.No. | Domain | Co-occurrence Frequency | No. of species in which domain occurs with smORF | Median distance b/w smORF and domain bearing ORFs | Orientation relative to smORF | PFAM Information |
|---|---|---|---|---|---|---|
| 1 | PF06572.14 | 0.67 | 2 | 4023.5 | same-strand | Protein of unknown function (DUF1131) |
| 2 | PF00881.26 | 1.0 | 3 | 3319 | same-strand | Nitroreductase family |
| 3 | PF08712.13 | 1.0 | 3 | 2677 | same-strand | Scaffold protein Nfu/NifU N terminal |
| 4 | PF01106.19 | 1.0 | 3 | 2677 | same-strand | NifU-like domain |
| 5 | PF00579.27 | 1.0 | 3 | 79 | same-strand | tRNA synthetases class I (W and Y) |
| 6 | PF03023.16 | 1.0 | 3 | 42 | same-strand | Lipid II flippase MurJ |
| 7 | PF14667.8 | 1.0 | 3 | 42 | same-strand | Polysaccharide biosynthesis C-terminal domain |
++ More..